ID: 1002651112

View in Genome Browser
Species Human (GRCh38)
Location 5:180695363-180695385
Sequence CAGTCTTTCACCACTGAGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002651112_1002651115 12 Left 1002651112 5:180695363-180695385 CCATACTCAGTGGTGAAAGACTG No data
Right 1002651115 5:180695398-180695420 CTAAAATCAGGAACAAGGTGAGG No data
1002651112_1002651116 19 Left 1002651112 5:180695363-180695385 CCATACTCAGTGGTGAAAGACTG No data
Right 1002651116 5:180695405-180695427 CAGGAACAAGGTGAGGATGTTGG No data
1002651112_1002651114 7 Left 1002651112 5:180695363-180695385 CCATACTCAGTGGTGAAAGACTG No data
Right 1002651114 5:180695393-180695415 TTCTTCTAAAATCAGGAACAAGG No data
1002651112_1002651113 0 Left 1002651112 5:180695363-180695385 CCATACTCAGTGGTGAAAGACTG No data
Right 1002651113 5:180695386-180695408 AAAGTTTTTCTTCTAAAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002651112 Original CRISPR CAGTCTTTCACCACTGAGTA TGG (reversed) Intergenic
No off target data available for this crispr