ID: 1002651116

View in Genome Browser
Species Human (GRCh38)
Location 5:180695405-180695427
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002651112_1002651116 19 Left 1002651112 5:180695363-180695385 CCATACTCAGTGGTGAAAGACTG No data
Right 1002651116 5:180695405-180695427 CAGGAACAAGGTGAGGATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002651116 Original CRISPR CAGGAACAAGGTGAGGATGT TGG Intergenic
No off target data available for this crispr