ID: 1002652605

View in Genome Browser
Species Human (GRCh38)
Location 5:180712193-180712215
Sequence GGGTGTGTATGTACATCTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002652601_1002652605 13 Left 1002652601 5:180712157-180712179 CCCTGCAAGCACTGCTTTGCTGC No data
Right 1002652605 5:180712193-180712215 GGGTGTGTATGTACATCTCAAGG No data
1002652602_1002652605 12 Left 1002652602 5:180712158-180712180 CCTGCAAGCACTGCTTTGCTGCA No data
Right 1002652605 5:180712193-180712215 GGGTGTGTATGTACATCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002652605 Original CRISPR GGGTGTGTATGTACATCTCA AGG Intergenic
No off target data available for this crispr