ID: 1002660016

View in Genome Browser
Species Human (GRCh38)
Location 5:180785509-180785531
Sequence CCCCTTGCTGGAGGGTTCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002660016_1002660027 22 Left 1002660016 5:180785509-180785531 CCCCAGAACCCTCCAGCAAGGGG No data
Right 1002660027 5:180785554-180785576 CATGAACTCCCTGGAGCTCAAGG No data
1002660016_1002660025 13 Left 1002660016 5:180785509-180785531 CCCCAGAACCCTCCAGCAAGGGG No data
Right 1002660025 5:180785545-180785567 GATGTCTTCCATGAACTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002660016 Original CRISPR CCCCTTGCTGGAGGGTTCTG GGG (reversed) Intergenic
No off target data available for this crispr