ID: 1002661030

View in Genome Browser
Species Human (GRCh38)
Location 5:180791271-180791293
Sequence CAGGTCAGGGAGAAGGGGTC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 581
Summary {0: 1, 1: 2, 2: 6, 3: 39, 4: 533}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002661023_1002661030 -8 Left 1002661023 5:180791256-180791278 CCTGGCTGGAAGAGCCAGGTCAG 0: 1
1: 1
2: 6
3: 30
4: 292
Right 1002661030 5:180791271-180791293 CAGGTCAGGGAGAAGGGGTCTGG 0: 1
1: 2
2: 6
3: 39
4: 533
1002661022_1002661030 -7 Left 1002661022 5:180791255-180791277 CCCTGGCTGGAAGAGCCAGGTCA 0: 1
1: 0
2: 2
3: 27
4: 259
Right 1002661030 5:180791271-180791293 CAGGTCAGGGAGAAGGGGTCTGG 0: 1
1: 2
2: 6
3: 39
4: 533

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002661030 Original CRISPR CAGGTCAGGGAGAAGGGGTC TGG Exonic
900476723 1:2879585-2879607 CAGCTGAGCAAGAAGGGGTCAGG - Intergenic
900477170 1:2881469-2881491 CAGGGCAGGGAGTGGGGATCCGG + Intergenic
900622763 1:3594944-3594966 CAGGGCAGGGAGAGGGACTCAGG + Intronic
900767609 1:4515609-4515631 CAGGGCAGAGAGCTGGGGTCTGG - Intergenic
900893200 1:5464581-5464603 CATGAAAGGAAGAAGGGGTCTGG + Intergenic
901019741 1:6249648-6249670 GCGGTCAGGGCGAAGGCGTCGGG + Exonic
903142956 1:21350683-21350705 CAGGGCAGGGGGAAGGGTCCTGG - Intergenic
903323080 1:22554085-22554107 CAGATCATGGAGAAGGAGCCAGG - Intergenic
903708339 1:25303378-25303400 CAAGCCACGGAGAAGGGATCAGG - Exonic
903718775 1:25389035-25389057 CAAGCCACGGAGAAGGGATCAGG + Exonic
904039921 1:27577762-27577784 CAGGTCAGGGGGAGGGGAGCAGG - Intronic
904079105 1:27860948-27860970 GAGGTCGGGGATAAGGGGTTGGG - Intergenic
904371206 1:30048556-30048578 CAGCTCAGGGAGAGGTGGACAGG - Intergenic
904428457 1:30446749-30446771 CACGACAGGGTGAAGGGTTCTGG + Intergenic
904498257 1:30899708-30899730 CCTGTCAGGGAGGAGGGGTAGGG + Intronic
904733426 1:32612250-32612272 GAGGTCAGGGAGCAGGGCACTGG - Intronic
905238998 1:36570623-36570645 GCGGTCAGGCAGAAGTGGTCCGG - Intergenic
905825769 1:41025004-41025026 CACATCAGGGAGAAGGGGGTTGG - Intergenic
905911457 1:41657826-41657848 CAGGTCCGGGACAAGGGGGTCGG + Intronic
906318495 1:44802929-44802951 TAGGGCAGGGCCAAGGGGTCAGG - Intronic
906614522 1:47225423-47225445 CAGGTCAGGGGCCAGGGGCCAGG - Exonic
906851717 1:49257870-49257892 CTGCTCAGGGATCAGGGGTCAGG - Intronic
910049930 1:82961473-82961495 CAGCTAAGGGAGATGGGGTGGGG - Intergenic
913086443 1:115441832-115441854 AAGGTCAGGGAGCAGAGGTAGGG - Intergenic
914063829 1:144229018-144229040 CAGGGCAGGGAGCAGGGTACAGG - Intergenic
914115321 1:144737336-144737358 CAGGGCAGGGAGCAGGGTACAGG + Intergenic
916479729 1:165204015-165204037 CAGGTCATGGAAAAGGGGCTCGG + Exonic
918038250 1:180896195-180896217 CAGATCAGGGATAAGGAGGCTGG + Intergenic
918143420 1:181736493-181736515 CAGGGCAGGGTGAAGGGGAGAGG + Intronic
918243632 1:182640933-182640955 GAGGTCAGGGATGAGGGGTGTGG - Intergenic
919119885 1:193326145-193326167 TATATCTGGGAGAAGGGGTCAGG - Intergenic
919783500 1:201239539-201239561 CTGCTCAGGGATCAGGGGTCAGG + Intergenic
920086213 1:203419308-203419330 CAAGGCAGGGAGAAGGGGGAGGG + Intergenic
920106145 1:203555091-203555113 CCGGTCAGTGAGAAGGGTACAGG + Intergenic
920266337 1:204726259-204726281 CTAGTCTGGGAGAAGGAGTCAGG + Intergenic
920267466 1:204734723-204734745 CTGGTGAGGGTGAAGAGGTCAGG + Intergenic
920698706 1:208201494-208201516 CAGGGCTGGGAGTAGGGGACAGG + Intronic
920964419 1:210690342-210690364 CAGCTCTGGGAGAAGAGGCCTGG - Intronic
922663290 1:227448328-227448350 AGGGTCGGGGAGAAGGGCTCTGG - Intergenic
922822703 1:228494998-228495020 CAGGGCAGGGGGAAGAGGCCAGG - Exonic
923394476 1:233547408-233547430 CAGTGCAGGGAGAAGGTGTCTGG - Intergenic
924701980 1:246463343-246463365 CAGGTCAGGGAGAGGGAGAGAGG + Intronic
1062923364 10:1296598-1296620 GAGGGCAGGGGGAAGGGGTCAGG + Intronic
1063022842 10:2146781-2146803 CAGGTCATGGAGCAGGGCTTTGG - Intergenic
1065188957 10:23193333-23193355 CAGCTCAGGGAGAAGGGGTCGGG + Intronic
1066654510 10:37685851-37685873 CAGGCCAGGGAGAGGTGGACAGG + Intergenic
1067698665 10:48553231-48553253 CAGTTCAGGGAGAGCGGGACGGG - Intronic
1068381149 10:56255190-56255212 CTGGTGAGGAAGAATGGGTCAGG + Intergenic
1068664419 10:59657910-59657932 AAGGTCAGGGGGATGGGGGCTGG + Intronic
1069148428 10:64924932-64924954 CTGCTCAGGGATCAGGGGTCAGG - Intergenic
1069606140 10:69739960-69739982 CAGGGCAGGAAGAACGGGGCAGG - Intergenic
1069773928 10:70916009-70916031 CGGGTCAGGGAGAGGGAGGCTGG + Intergenic
1069825454 10:71252718-71252740 CAGGTCTCTGTGAAGGGGTCTGG - Intronic
1070598586 10:77849722-77849744 CAGGAAAGGGAGAGGGGGACAGG + Intronic
1070723403 10:78772205-78772227 GAGGGCAGAGACAAGGGGTCAGG - Intergenic
1071270641 10:84003811-84003833 AAGGTGAGGAAGGAGGGGTCAGG - Intergenic
1071503516 10:86219543-86219565 CAGAGCAGGGAGAAGGGGAGCGG - Intronic
1073456143 10:103637867-103637889 GAGGTCATGGGAAAGGGGTCAGG - Intronic
1075219493 10:120572329-120572351 CAGGGCATGGAGAAGGGGAAGGG - Intronic
1075413191 10:122244175-122244197 CACATCAGGGAGCAGGGGTGGGG - Intronic
1075799709 10:125145821-125145843 CTGGCCAGGGACCAGGGGTCTGG - Intronic
1076350441 10:129811546-129811568 CAGCACCGGGAGAAGGGGGCAGG - Intergenic
1076633930 10:131870511-131870533 CAGGTGAGGGTGAAGGGACCTGG - Intergenic
1076756670 10:132576167-132576189 CAGGTGAGGGAGCCGTGGTCCGG + Intronic
1076921693 10:133457636-133457658 GAGGGCAGGGAGAAGGGGGGTGG + Intergenic
1077363397 11:2151222-2151244 GAGAGCAGGGAGAAGCGGTCAGG + Intronic
1077652454 11:3985509-3985531 CAGGTTAGGGACAAAGGGTTTGG + Intronic
1078670646 11:13362041-13362063 CAGGCAAGAGAGAAGGGGCCTGG + Intronic
1079356921 11:19737434-19737456 CATGGCAGGGAGAAGGGATGGGG + Intronic
1079645549 11:22860444-22860466 CAGGACAGGCAGTAGGCGTCAGG - Intergenic
1079726612 11:23887362-23887384 CAGATAAGGGAGATGGGGTTGGG + Intergenic
1080552246 11:33382809-33382831 CAGGGCAGGGAGAGGGTGCCAGG - Intergenic
1080934934 11:36853164-36853186 TGGGTAAGGGAGCAGGGGTCAGG + Intergenic
1081577500 11:44328339-44328361 CAGGCCAGGGTGAAGGGGCAGGG - Intergenic
1081666301 11:44918883-44918905 CAGCTCAGGTGGAAGGGGTGGGG + Intronic
1082937691 11:58671483-58671505 CATGACAGGGACAAGAGGTCAGG + Intronic
1083048419 11:59755984-59756006 CAGGAAAGGGAGAAGGAGGCTGG - Intronic
1084088317 11:66864853-66864875 CAGGTAAGGAAGAAGGGGAGTGG + Intronic
1084182705 11:67454707-67454729 CAGGGCTGGGGGAGGGGGTCTGG - Intronic
1084192013 11:67503731-67503753 GAGGTCAGGGAGATGTGGTGAGG - Intronic
1084530261 11:69723148-69723170 CACGCCAGGGAGAGGGGCTCAGG + Intergenic
1085772850 11:79340304-79340326 CAGCCCAGGGAGGTGGGGTCAGG + Intronic
1086871673 11:92044897-92044919 CATGTCAGGGAGTGGGGGGCGGG + Intergenic
1087157262 11:94917582-94917604 CAGCTTAGGCAGATGGGGTCTGG - Intergenic
1088679284 11:112225714-112225736 CCTGTCAGGGAGTAGGGGGCTGG + Intergenic
1089043797 11:115481112-115481134 AGGGTGAGGGAGAAGGGGACTGG - Intronic
1089183455 11:116598713-116598735 CATGAAAGGGAGAAGGGGCCTGG + Intergenic
1089624676 11:119743487-119743509 CAGGTGAGGGAGGAGGGGGAAGG - Intergenic
1090268907 11:125371866-125371888 CAGGTCAGGGATAGAGGGTGAGG + Intronic
1090412972 11:126521481-126521503 CAGGTCAGGGAGCTGGGGTGGGG + Intronic
1090537837 11:127664188-127664210 CAGGGAAGGGAGTAGCGGTCAGG + Intergenic
1091224818 11:133951022-133951044 CTTGTCAGGGAGGAGGGGTTGGG - Intronic
1091994091 12:4979087-4979109 GAGGCCAGGGAGGAGGGGTGCGG + Intergenic
1092170928 12:6373776-6373798 CAGAACAAGGAGAATGGGTCAGG - Intronic
1092290838 12:7158673-7158695 CAGGTCACGGAGGAGGGGCCGGG - Exonic
1092394853 12:8116728-8116750 CAGGTCAGGGAGACAGTGTGGGG + Intergenic
1092672826 12:10882780-10882802 CAGGTCAGGCAGAGAGGGGCCGG - Intronic
1092676887 12:10930558-10930580 CAGGTCAGGGAGAGAGGGGCCGG + Intronic
1093495808 12:19756018-19756040 CAGGTGAGGGAGATGGGGAAAGG - Intergenic
1093546503 12:20354985-20355007 CAGGGCAGGGAGATGGGTTGTGG + Intergenic
1094400476 12:30057037-30057059 AGGGTGAGGGAGAAGGGGTTGGG - Intergenic
1094401266 12:30062394-30062416 CAGGGAAGGGAGATGGGGTGGGG - Intergenic
1094735391 12:33228267-33228289 CTGCTCAGGGATCAGGGGTCAGG - Intergenic
1095830572 12:46582009-46582031 CTGGTCAGGGGGTGGGGGTCTGG - Intergenic
1095955454 12:47803202-47803224 CAGTTCAGGGTCAAGGGGACAGG + Intronic
1096744236 12:53715128-53715150 CAAGACAGAGAGAAGGGGTATGG + Intronic
1096813809 12:54188931-54188953 CAGGTGAGGAAGTAGGGGGCTGG - Exonic
1096845268 12:54403157-54403179 CAGGGCAGGGAGAAGGGACCTGG - Intronic
1097246189 12:57609087-57609109 CGGGTCAGGTAGGTGGGGTCTGG - Exonic
1097249130 12:57622792-57622814 CAGGTTGGGGAGGAGGGGTTGGG - Exonic
1097455762 12:59796547-59796569 CCAGTCAGGGAGCAGGGGTCTGG - Intergenic
1097606697 12:61763796-61763818 GAGGTCAGAGAGAAGGGAGCAGG + Intronic
1100145518 12:91672858-91672880 CAGGTCAAGGAGTTGGGGTGGGG - Intergenic
1101449196 12:104761105-104761127 GAGGGCAGGGAGGCGGGGTCTGG - Exonic
1101546905 12:105722427-105722449 AAAGTCAGGGAGAAGGGACCTGG - Intergenic
1101910122 12:108855324-108855346 AAGGTTAGGGAGAATGGGGCAGG + Intronic
1102176815 12:110882099-110882121 CAGCACAGGGAGAAGGTGTGTGG + Intronic
1103119676 12:118371385-118371407 CGGGCCAGTGAGAAGAGGTCAGG + Intronic
1103380181 12:120488189-120488211 CAAGACAGGGAGTAGGGGTGGGG - Intronic
1104891772 12:132143731-132143753 CAGGCCGGGGACCAGGGGTCCGG + Exonic
1105018065 12:132798161-132798183 CAGGTGAGGGATGAGGGGTGGGG + Intronic
1105811772 13:24001793-24001815 GAGGTGAGGGAGCAGGGGTGAGG + Intronic
1106106022 13:26734273-26734295 CTGGTCAGTGAGAAAGGGTAGGG - Intergenic
1106473112 13:30075651-30075673 CAGGTCGGAGGGATGGGGTCTGG + Intergenic
1106533600 13:30618054-30618076 CAGGTAAGGGAGAAGAGGGAGGG + Exonic
1106581458 13:31022080-31022102 GTGGTCAGAGTGAAGGGGTCGGG - Intergenic
1107982438 13:45746414-45746436 CAGGTCAGGGGGAACAGGCCGGG - Intergenic
1110707275 13:78609572-78609594 CGGGTTGGGGAGATGGGGTCCGG - Intergenic
1112236510 13:97642590-97642612 CAGCTAAGGGAGATGGGGTGGGG - Intergenic
1112524305 13:100129532-100129554 CTGGTCAGGGAGAAGGTGGGAGG - Intronic
1113014929 13:105818041-105818063 AAGGCCAGGGAGAAGTGGGCAGG + Intergenic
1114388616 14:22281809-22281831 AAGGTCAGGGGGAAGTGTTCAGG + Intergenic
1114428366 14:22639491-22639513 CAGCTCATTGAGAACGGGTCAGG + Intergenic
1115979445 14:39033658-39033680 AATGCCAGGGAGAAAGGGTCTGG - Intronic
1116672412 14:47860509-47860531 CAGGACAAGGAGTAGTGGTCAGG + Intergenic
1116859164 14:49979817-49979839 CAGTTCAAGGAGACAGGGTCTGG - Intergenic
1117063899 14:51989719-51989741 CAGGTCAGGGACACGCGGCCGGG - Intronic
1117105175 14:52390925-52390947 CAGGTCAAGGAGATGGTGTTTGG + Intergenic
1117546499 14:56798120-56798142 CTGGCCGGGGAGAAGGGGCCGGG - Intergenic
1117893178 14:60449029-60449051 CCTGTCAGGGAGTAGGGGGCTGG + Intronic
1118358383 14:65035191-65035213 CAGGCCAGGGGTCAGGGGTCAGG - Intronic
1118889284 14:69894495-69894517 CATTTCTGGGACAAGGGGTCAGG + Intronic
1119388559 14:74274868-74274890 CCAGTCAGAGAAAAGGGGTCTGG - Intergenic
1119514484 14:75237239-75237261 CAGGCCAGAGAGAAGCGGTAGGG + Intergenic
1119643411 14:76330798-76330820 CAGGTCTGGGGGATGGGGGCAGG + Intronic
1120069729 14:80089226-80089248 CTGCTCAGGGATCAGGGGTCAGG - Intergenic
1120438279 14:84505009-84505031 AAGGTGAAGGAGAAGGGGTTGGG + Intergenic
1121237480 14:92403076-92403098 CAGGTCCTGCAGAAGGGGACAGG + Intronic
1121325523 14:93017568-93017590 CGGGTCAGGAAGCGGGGGTCAGG - Intronic
1121950031 14:98163628-98163650 CAGGGCAGGGAGGAGGGGACAGG - Intergenic
1122034915 14:98940913-98940935 CTGGTCTGGTAGAAGGAGTCTGG + Intergenic
1122227336 14:100287365-100287387 AAGGGCAGAGAGAAGGGGGCAGG - Intergenic
1122388108 14:101362610-101362632 CAGGTCGGGGAGAAGGTGGCCGG - Intergenic
1122847926 14:104510864-104510886 CAGGTCAGAGTGCAGGGGTGGGG + Intronic
1123830416 15:24130306-24130328 CAGGGCACGCAGAAGGGGTGTGG + Intergenic
1123841276 15:24249763-24249785 CAGGCCATGCAGAAGGGGTGTGG + Intergenic
1123850671 15:24352912-24352934 CAGGGCACGCAGAAGGGGTGTGG + Intergenic
1123855543 15:24407147-24407169 CAGGGCACGCAGAAGGGTTCTGG + Intergenic
1123860443 15:24460718-24460740 CAGGGCATGCAGAAGGGGTGTGG + Intergenic
1123864073 15:24499337-24499359 CAGGGCATGCAGAAGGGGTGTGG + Intergenic
1124343839 15:28908103-28908125 CAGCTCAGGGACAACGGCTCGGG - Intronic
1125079605 15:35657078-35657100 CAGCTCATTGAGAAGGGGCCAGG + Intergenic
1125433063 15:39616828-39616850 GAGGTCTGGGAGAAGGGTTATGG + Intronic
1125929217 15:43588511-43588533 CAAGTCAGGGAAATTGGGTCAGG - Intronic
1125942384 15:43688343-43688365 CAAGTCAGGGAAATTGGGTCAGG - Intergenic
1126065332 15:44822215-44822237 CAGGTCAGGCACAAGGGGAAGGG + Intergenic
1126094501 15:45078368-45078390 CAGGTCAGGCACAAGGGGAAGGG - Intergenic
1126843533 15:52739534-52739556 AAGGTGAAGGAGAAGGGGTTGGG - Intergenic
1128067596 15:64774753-64774775 AAGGTCACGGGGAGGGGGTCAGG + Intronic
1128264005 15:66252561-66252583 CAGGTCCGGGAGAAGCCGCCCGG + Intronic
1128660762 15:69499410-69499432 CCGGTCAGGGATGAGAGGTCTGG + Intergenic
1128695542 15:69759329-69759351 AAGGTCACGGAGAAGAGGTGGGG - Intergenic
1128987902 15:72234650-72234672 CAGGTATGGGGGAAGGGGCCTGG - Intergenic
1129429942 15:75492515-75492537 CAGGACAATGAGAATGGGTCAGG - Intronic
1129460688 15:75698707-75698729 CAGGCAAGGGAGAAGCTGTCTGG + Intronic
1129724181 15:77893333-77893355 CAGGCAAGGGAGAAGCTGTCTGG - Intergenic
1130230451 15:82092854-82092876 CAGGTCAAGGAAAGGGGGCCGGG + Intergenic
1130547447 15:84867524-84867546 CAGGCCAGAGATAAGGGGTGGGG - Intronic
1130794551 15:87194991-87195013 CACGGCAGGAGGAAGGGGTCAGG - Intergenic
1131127688 15:89869077-89869099 CAGCTCATTGAGAACGGGTCAGG + Intronic
1131141242 15:89978258-89978280 CAGCTCATTGAGAAGGGGCCAGG + Intergenic
1131145043 15:90005358-90005380 CAGGTGAGGCAGGAGGGGGCTGG + Intronic
1132404378 15:101533485-101533507 CAGGGCAGGGAGCAGTGGTGGGG - Intergenic
1132621215 16:869052-869074 TAGGTCTGGGAGGAGAGGTCGGG + Exonic
1132926028 16:2429531-2429553 CAGGGCAGGCAGAAGGGGTGTGG - Intronic
1133027587 16:2995435-2995457 CAGGTGAGACAGATGGGGTCTGG + Intergenic
1133585104 16:7185929-7185951 GAGGACGGGGAGAAAGGGTCAGG - Intronic
1133698870 16:8290341-8290363 CATGGCAGTGGGAAGGGGTCAGG - Intergenic
1133937947 16:10284138-10284160 CAGGAAAGTGAGAAGGGGTGGGG - Intergenic
1134093473 16:11403867-11403889 CCGGGCAGGGAGAAGGGGCCAGG - Intronic
1134378397 16:13701229-13701251 CAGGCCCAGGAGAAGGGGTAAGG - Intergenic
1134674906 16:16083478-16083500 CAGGTCTGGGAGGAGGGCACAGG - Exonic
1134849345 16:17468240-17468262 CAGGTCATGGAGTAGGTGTGGGG + Intronic
1135612341 16:23879393-23879415 CATGTCAAGGAGAAGGTGCCTGG - Intronic
1135770759 16:25216798-25216820 CAGGGCAGGGTGAGGGAGTCAGG - Intronic
1136547062 16:30961093-30961115 GAATTCAGGGAAAAGGGGTCAGG + Intronic
1136635186 16:31516620-31516642 CAGGTCAGAGATATGGGCTCAGG + Intergenic
1137785658 16:51135156-51135178 CAGGTAAGGTAGAAAGCGTCGGG - Intergenic
1138106063 16:54287603-54287625 CGGGACCGGGAGAAGGGGTAGGG - Intergenic
1138111992 16:54331075-54331097 CAGGTAAGGGAGGAGGGACCTGG - Intergenic
1138251189 16:55503053-55503075 CAGGCCAAGGAGCAGAGGTCAGG - Intronic
1138528952 16:57624729-57624751 CAGGACAGGGATAAGGGGTTAGG - Intronic
1138582046 16:57948033-57948055 CAGGTCAGGGAGAAAGGACGCGG + Intronic
1138626980 16:58260229-58260251 CATGAGAGGGAGAAGGGGTCAGG + Intronic
1139210692 16:65073789-65073811 CAGGTCTGGGAAAAGGGATGAGG + Intronic
1139476126 16:67203374-67203396 CATGTCCGGGAGAAGGGCTCCGG + Exonic
1139844379 16:69909229-69909251 AAGTTCAAGGAGAAGGGGTTTGG + Intronic
1139953364 16:70682269-70682291 CAGCTCAGGGTGAAGGGGCCTGG + Intronic
1140407607 16:74721486-74721508 CAGGTGAGGGAGATGGAGTAAGG - Intronic
1140559408 16:75960583-75960605 AATGTCAAGGAGAAGGGGTCAGG - Intergenic
1140705549 16:77625493-77625515 CAGGCCAGGGAAAATGGGGCTGG + Intergenic
1141434762 16:83993752-83993774 CAGGGCCGGGAGATGGGGCCAGG + Intronic
1141551851 16:84811550-84811572 TAGGTGAGGGAGAAGGGGAACGG - Intergenic
1141991951 16:87615659-87615681 CGGGTCAGGGAGGCCGGGTCAGG - Intronic
1142050662 16:87956017-87956039 GAGGTGAGGGAGTAGGGGTTTGG + Intronic
1142157495 16:88539291-88539313 CAGCTCAGGTAGAAGGGAGCAGG - Intergenic
1142290915 16:89193260-89193282 GAGGTTAGGGAGGAGGGGGCCGG - Intronic
1142812048 17:2399974-2399996 CAGCTCTGGGAGGCGGGGTCAGG + Intronic
1142957174 17:3529981-3530003 AAGGGCAGGGAGAAGAGGGCTGG - Intronic
1143018423 17:3904077-3904099 GAGCTCCTGGAGAAGGGGTCTGG - Intronic
1143139993 17:4736548-4736570 GAGGTTAGGGACAAGGGGTGAGG - Intronic
1143197561 17:5087785-5087807 CAGGGCAGGAGAAAGGGGTCAGG - Intronic
1143326697 17:6103687-6103709 CAGCGCACGGAGAAGGGGACTGG + Intronic
1143622592 17:8089353-8089375 CAGGATAGGGAGAAGGTGTTAGG + Intergenic
1144431781 17:15198969-15198991 CTGGTGAGGAAGAATGGGTCGGG - Intergenic
1144625005 17:16840079-16840101 CAGGTATGGGAGAAAGGGTGGGG - Intergenic
1144703575 17:17353489-17353511 CAGGACAGGCAGAAAGGGTCAGG + Intergenic
1144783509 17:17819524-17819546 CAGGTCCCGGTGAGGGGGTCTGG - Exonic
1144829389 17:18122926-18122948 TAGGTCAGGGTGAGGGGCTCAGG + Intronic
1144881425 17:18432642-18432664 CAGGTATGGGAGAAAGGGTGGGG + Intergenic
1145150808 17:20511744-20511766 CAGGTATGGGAGAAAGGGTGGGG - Intergenic
1145275207 17:21425004-21425026 CAGGCCAGGGAGGAGGGCCCTGG + Intergenic
1145313062 17:21710901-21710923 CAGGCCAGGGAGGAGGGCCCTGG + Intergenic
1145711483 17:26982707-26982729 CAGGCCAGGGAGGAGGGCCCTGG + Intergenic
1146966312 17:37033971-37033993 CAAGCAAGGGAGAAGGGGTTAGG + Intronic
1147579159 17:41618776-41618798 CAGGTGTGGGAGAAAGGGTGGGG - Intergenic
1149567972 17:57652972-57652994 CAGTTCAGGGAGCAGGGGTGGGG - Intronic
1149891172 17:60391862-60391884 GAGGTGAGGGGGGAGGGGTCTGG - Exonic
1150557860 17:66269478-66269500 CAGCTCATTGAGAACGGGTCAGG + Intergenic
1151120849 17:71791207-71791229 CACTTCAGGGAGAAGGGCTGAGG - Intergenic
1151155068 17:72118314-72118336 CAGGTCAGGGAGGAGGGGTCGGG + Intergenic
1151340051 17:73465367-73465389 GAGGGCTGGGGGAAGGGGTCAGG + Intronic
1151679045 17:75614372-75614394 CAGGCCAGGGAGAGGGGTGCTGG - Intergenic
1151723920 17:75874016-75874038 CTGGCCTGGGAGAAGGGGGCTGG - Intergenic
1151729044 17:75900203-75900225 CAGGCCAGGGGGCAGAGGTCAGG - Intronic
1151994022 17:77597354-77597376 CAGCTCAGGGAGGAGCAGTCAGG - Intergenic
1152042120 17:77910135-77910157 GAGGACAGGGAGAGGGGGCCTGG - Intergenic
1152318136 17:79592875-79592897 CTGGGCAGGGAGAAGGGGCAGGG - Intergenic
1152514949 17:80817628-80817650 CAGGTCCGGGAGAAGGGGTGGGG + Intronic
1152544549 17:80994233-80994255 CAGGTCAGGGAGCAGCTGCCAGG - Intronic
1152592132 17:81218880-81218902 CAGGGCAGAGAGAAGGGGTCTGG - Intronic
1152593964 17:81229281-81229303 CAGATGAGGGAGCAGGGCTCCGG + Exonic
1153545894 18:6204374-6204396 CAGCTGTGGGAGAAGGGGTGGGG - Intronic
1154406055 18:14092235-14092257 CAGGACCAGGATAAGGGGTCAGG + Intronic
1154496520 18:14965198-14965220 CAGGTGAGGGAGAAGAGTCCAGG + Intergenic
1158195713 18:54882967-54882989 CAGGTGAGAGAGAATGGGTTTGG + Intronic
1158796690 18:60855091-60855113 AAGGTCAGGGACAACTGGTCTGG - Intergenic
1160261193 18:77295763-77295785 CAGGCAAGGGAGAAGGTGGCTGG + Intergenic
1160573168 18:79832216-79832238 CAGGTGAGGAAGGAGGGGTGAGG - Intergenic
1160581277 18:79885783-79885805 CAGGACAGGGAGATGGGGATGGG + Intronic
1161015165 19:1979726-1979748 TGGGTGAGGGAGCAGGGGTCAGG - Intronic
1161243272 19:3234825-3234847 CAGGTGAGGGATGAGGGGGCTGG - Intronic
1161497669 19:4596464-4596486 CGGGCCAGGGAGGAGGGGCCTGG + Intergenic
1162367209 19:10256830-10256852 CAGGACAGGGTGGAGGGGGCGGG + Intronic
1162917806 19:13883583-13883605 CAGGTAGGGGAGAAGCGGTTGGG - Intronic
1163019579 19:14475150-14475172 CAGATCAGGGAGAAGAGCCCGGG + Intronic
1163103556 19:15110811-15110833 CAGGCCTGGGGGTAGGGGTCTGG - Intronic
1163552112 19:17971278-17971300 CAGGCCTGGGAGAAGGGTTGGGG - Intronic
1165058140 19:33191877-33191899 CAGGTGAGGGAGCAGTGGTGGGG - Intronic
1165561729 19:36686306-36686328 AAGGCAAGGGAGAAGGGGTAAGG + Intergenic
1165786793 19:38466454-38466476 CAGGTCAGAGATCAGGGATCGGG - Intronic
1166069945 19:40381173-40381195 CGGGGCATGGAGAAGGGGGCAGG + Intronic
1166326123 19:42052252-42052274 AAGGTCAGGGAGGGGAGGTCAGG - Intronic
1166529374 19:43533519-43533541 CAGGTGAGGGCGCAGGGGTTCGG + Exonic
1167490618 19:49790872-49790894 CTGGACAGGCCGAAGGGGTCCGG + Intronic
1167560727 19:50225537-50225559 GAGGTCAGTGAGAATGGGGCAGG - Intronic
1167674805 19:50877539-50877561 CAGGCCTGGGAGGAGGGGCCGGG + Intronic
1167681918 19:50928800-50928822 CAGCTCAGGGAGACAGAGTCAGG - Intergenic
1167741119 19:51325551-51325573 GGGGCCAGGGAGAAGGGGGCTGG - Intronic
1167777292 19:51566750-51566772 CATGTTTGGAAGAAGGGGTCAGG + Intergenic
1167935718 19:52905382-52905404 CAGGGAAGGGAGATGGGGTGGGG - Intergenic
1167994330 19:53390283-53390305 CAGGACAGCGAGAAGGGCTGGGG + Intronic
1168018154 19:53589931-53589953 GAGGTATGGGAGAAGGGGTGAGG + Intergenic
1168308515 19:55449697-55449719 CAGCTGAGGGGGAAGGGGCCCGG + Intergenic
1168723642 19:58569257-58569279 CAGGTAAGTGAGATGGGGTGTGG - Exonic
924960813 2:32916-32938 GAGGTTAGGGGGCAGGGGTCGGG - Intergenic
925130091 2:1488519-1488541 CAGGTCAGGGAGGAGGCTGCCGG - Intronic
925589225 2:5493498-5493520 CAAGTGAGGGAGAAGGGGGCCGG - Intergenic
925763975 2:7213190-7213212 GAGGTCAGGGAGAGTGGGCCTGG + Intergenic
925999657 2:9319988-9320010 CAGGGCAGGGAGTAGGGCACAGG + Intronic
927573356 2:24179714-24179736 CAGGGCAGGAGGAAGGGGTAAGG + Intronic
927633856 2:24797212-24797234 TGGGTCAGGGAGAAGGTGTGAGG + Intronic
927929257 2:27033554-27033576 CAGGTCATGGAGGAAGGGACAGG + Intronic
928115975 2:28545472-28545494 CAGGTTAGGGCGAAGGGCACTGG + Intronic
928168539 2:28988461-28988483 CAGCTGAGGGAGAAGGGCACAGG - Intronic
929366567 2:41165126-41165148 ATAGTCAGGAAGAAGGGGTCTGG - Intergenic
929677193 2:43948306-43948328 CATGTCATTGAGAAGTGGTCTGG + Intronic
929759027 2:44790881-44790903 CAGGTCAGGGAGGCGGATTCTGG - Intergenic
932419018 2:71590557-71590579 CAGGTCAGGGAGGAGGCTGCAGG - Intronic
932471538 2:71962623-71962645 CAGCTCAGGGAGGAGGAGTGTGG - Intergenic
933182552 2:79243771-79243793 GAGGGAAGGGAGAAGGGGTAAGG + Intronic
933422140 2:82062223-82062245 CAGGTGAGGGAGAAGGCGGAAGG - Intergenic
934568209 2:95352333-95352355 CAGGTCAGGGAGAAAGAGCAGGG + Intronic
935578258 2:104733363-104733385 CAGGTCAAGAAGAAGGTGTTGGG + Intergenic
936036476 2:109117065-109117087 CTGCTCAGGGATCAGGGGTCAGG + Intergenic
936794662 2:116190643-116190665 CAGGGAAGGGAGATGGGGTGGGG + Intergenic
936985812 2:118310614-118310636 CAGCGCAGGAAGAAGGGGTGAGG + Intergenic
937045603 2:118849666-118849688 CATTTCGGGGAGAAGGGGTGGGG - Intergenic
937246551 2:120497592-120497614 CAGCTCAGGGAGGTGGTGTCAGG + Intergenic
937276852 2:120690459-120690481 GAGGTCAGGGAGGAGGGGACGGG + Intergenic
937861912 2:126718089-126718111 AAGATCAGGGAGAAGTGTTCTGG - Intergenic
937863859 2:126733318-126733340 GAGGGCAGGGAGGAGGGGGCAGG + Intergenic
938054032 2:128199879-128199901 CAGGGTCGGGAGAACGGGTCAGG - Intergenic
938210222 2:129460728-129460750 CAGGCTATGGAGAAGGGGACAGG + Intergenic
938467391 2:131532647-131532669 CAGGGCAGGCAGATGGGGGCGGG + Exonic
939519810 2:143215540-143215562 CAGCTCAGGGAGAAGGGTGTGGG + Intronic
939610024 2:144298706-144298728 CAGGAAAGGGAGGAGAGGTCAGG + Intronic
941159093 2:162015614-162015636 TAGGTCAGGGAGGAGGGAGCCGG - Intronic
942096912 2:172542867-172542889 AAAGACAGAGAGAAGGGGTCGGG - Intergenic
942126317 2:172828998-172829020 CAGCTCAGGGAACAGGGATCAGG + Intronic
942224380 2:173802462-173802484 GAGGTATGGGAGAAGGGGTGTGG + Intergenic
943707107 2:191047192-191047214 CAAGGCATGGAGAAGGGGTGTGG - Intronic
944159073 2:196639860-196639882 CAGGACAGGGAGAGGGCGCCAGG - Intronic
944975285 2:205042820-205042842 CAGGACAGGGAGAAGGGATGAGG - Intronic
945908332 2:215619143-215619165 GTGGTCAGGGTGGAGGGGTCAGG - Intergenic
946027972 2:216683541-216683563 CAGGTGAGGGAGAGGGGAACAGG + Intronic
946177570 2:217930842-217930864 TAGGTCAGGGAGAAGGGGTGGGG - Intronic
946302312 2:218831424-218831446 GTGTTCAGGGAGAAGGGGTTTGG - Intronic
946344288 2:219095679-219095701 TAGTTCAGGGAGGAGGGGTATGG + Intronic
946411108 2:219515559-219515581 CAGGTCTGGGAGTTGGGGTGGGG + Intronic
946838382 2:223795578-223795600 TAGGCCAGGCAGAAGGGGCCAGG + Intronic
947308717 2:228776780-228776802 CAGGTCAGGGAGAAGGGCACTGG + Intergenic
947388112 2:229612467-229612489 CAGGTGAGGGAGAACAGCTCTGG + Intronic
947753459 2:232544671-232544693 CAGGTCAGGGAGAGAGGAGCTGG + Intronic
947864206 2:233384866-233384888 CAGGCCAGGGAGGAGGGGCTGGG - Intronic
948029046 2:234801351-234801373 CAGAGCAGGGAGGATGGGTCTGG + Intergenic
948757979 2:240170126-240170148 GGGGTCAGGGAACAGGGGTCAGG + Intergenic
948879933 2:240851489-240851511 CAGCTCAGGGGGGACGGGTCTGG - Intergenic
1168971228 20:1932288-1932310 CAGATCAAGGAGGTGGGGTCTGG + Intronic
1169075895 20:2759643-2759665 CAGCTCAGGGAGAAGTGACCTGG + Exonic
1169404373 20:5311283-5311305 CAGGATAGGGAGAAAGGGTAAGG + Intronic
1169963342 20:11187554-11187576 GAGGTAAGGGAAAAGGGGTATGG + Intergenic
1171412596 20:24957046-24957068 CAGGTGAGGGAGAACAGGTGAGG + Intronic
1172785593 20:37466314-37466336 CAGGAAAGGGAGAGGAGGTCCGG - Intergenic
1172948558 20:38706885-38706907 AAGGTGAGGGAGAAGGGTTCAGG - Intergenic
1173545940 20:43898060-43898082 GAGGTCTGGGAGAAGAGGCCGGG + Intergenic
1173805577 20:45922773-45922795 AAGGTGAGGTAGAAGGGGCCTGG - Intergenic
1174215285 20:48911776-48911798 GAGGTCAGGGAGAGGGAGGCAGG - Intergenic
1174379235 20:50146113-50146135 CAGGTCCCTGTGAAGGGGTCAGG + Intronic
1175190195 20:57206610-57206632 CAGGTGATGGAGAAGGGATAAGG + Intronic
1175294348 20:57898019-57898041 CAGGTAAGGGAGATGGAGCCTGG - Intergenic
1175412203 20:58777739-58777761 CAGGGCAGGCAGCAGGGGCCAGG - Intergenic
1175547574 20:59788508-59788530 CGGGTCAGGGAAGAGGGGCCAGG - Intronic
1175998074 20:62820211-62820233 CATGGCAGGGAGAAGGGGGATGG + Intronic
1176039388 20:63056341-63056363 CAGGGAAGGGGGAAGGGGTGTGG - Intergenic
1176198466 20:63848537-63848559 CAGGGCAGTGAGCAGAGGTCGGG - Intergenic
1176717388 21:10364586-10364608 CAGGTCCTGGAGAAGGGGCAAGG - Intergenic
1176932440 21:14829564-14829586 CAGCTCTGGGAGAAGGGTTGTGG - Intergenic
1177825764 21:26081314-26081336 CAGGAAAGGGAGATGGGGTAGGG + Intronic
1178074928 21:29006094-29006116 CAGGTAAGGGAGAAGGGGGTTGG + Exonic
1179557386 21:42188521-42188543 TAGCCCAGGGAGAAGGGGGCTGG + Intergenic
1179731835 21:43372557-43372579 GGGGTCAGGGAGATGGGGCCTGG - Intergenic
1179879547 21:44287627-44287649 CTGGCCAGGGGCAAGGGGTCAGG + Intronic
1179967264 21:44814717-44814739 CAGGGCAGCGAGAAGGAGCCTGG - Intronic
1180042471 21:45287518-45287540 GGGGTCAGGGGGCAGGGGTCAGG - Intronic
1180298612 22:11017506-11017528 CAGGTCCTGGAGAAGGGGCAAGG - Intergenic
1181674833 22:24444786-24444808 GAGGTCTGAGAGCAGGGGTCTGG + Intergenic
1182072761 22:27475188-27475210 AAGCTCAGGGAGAAGGAGGCTGG + Intergenic
1182623685 22:31631024-31631046 AAGGCCAGGGAGAAGGGGAAGGG + Intronic
1183350275 22:37331038-37331060 CAGGCCAGGGAGGAGGGGGAAGG - Intergenic
1183485702 22:38086634-38086656 CAGGGCAGAGAGAGGGGCTCAGG + Intronic
1183773611 22:39947927-39947949 GAGGTCAGGCAGAGGGGGTCTGG - Intronic
1184300264 22:43554591-43554613 CAGGGAAGGGAGAAGGAGTGTGG + Intronic
1184419559 22:44371768-44371790 CAGGACAGGGTGCAGGTGTCTGG - Intergenic
1184806647 22:46798879-46798901 CAGGGCAGGGAGAGGGTTTCCGG + Intronic
1184912745 22:47547238-47547260 CAGCTCAGGGAGAAGATGACAGG - Intergenic
1185047297 22:48534798-48534820 CAGGTCAGGGACACGGGGCTGGG + Intronic
1185105968 22:48870055-48870077 CAGGGCAGAGAGAAGGGGAATGG - Intergenic
949506377 3:4731969-4731991 GAGGTGAGGGAGAAGAAGTCTGG - Intronic
950414059 3:12858307-12858329 CCAGTCAGGAAGAAGAGGTCTGG + Intronic
950778821 3:15373627-15373649 CAGGTCATGGAGAGGGCCTCAGG - Intergenic
950842012 3:15976745-15976767 CATGTGAGGGAGACAGGGTCAGG - Intergenic
951208410 3:19947617-19947639 CGCGTGAGGGAGAAGGGGTGGGG - Intronic
952945783 3:38477214-38477236 CAGGACTGGGAGTAGGGGTTTGG + Intronic
953752051 3:45616481-45616503 TGGGTGAGGAAGAAGGGGTCGGG - Intronic
954379348 3:50211313-50211335 CAGGGCAGGGAGGAGGGCTGGGG - Intronic
954621784 3:52000579-52000601 CAGGTGAGGGAGACGGGGCTTGG + Intergenic
955958592 3:64316338-64316360 GAGGTAAGGGGGAAGGGGTGTGG - Intronic
957305343 3:78450831-78450853 CAAGAGAGGGAGAAGGTGTCAGG + Intergenic
957610016 3:82453833-82453855 TAGAGCAGGGAGAAGGGGGCAGG - Intergenic
960693963 3:120377922-120377944 CTGCTCAGGGATCAGGGGTCAGG + Intergenic
960965862 3:123104307-123104329 CAGGGCAGAGGGAAGGGGACAGG + Intronic
961642399 3:128372815-128372837 CAGGTTAGGGTGAAGGGTGCTGG + Intronic
961657580 3:128451933-128451955 CAGTGCAGGGAGCAGGTGTCTGG - Intergenic
961712866 3:128840616-128840638 CAGCCCAGGGAGAAGGGGAGAGG + Intergenic
961823519 3:129587160-129587182 CAGGCCAGGCTGATGGGGTCAGG + Intronic
962813250 3:138976714-138976736 CAGGTCAGGGAGCAGGGCAGAGG - Intergenic
963274719 3:143318647-143318669 CATGTCAGGGAGAACTGGTGAGG - Intronic
964983453 3:162713452-162713474 AGGGTGAAGGAGAAGGGGTCGGG - Intergenic
965382868 3:168011729-168011751 CTGCTCAGGGGTAAGGGGTCAGG - Intronic
966075616 3:175933476-175933498 CAGGAAAGGGAGCAGGGGACAGG + Intergenic
966757560 3:183385724-183385746 GTGGTCAGGGAAAAGGGGACTGG - Intronic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
968497559 4:927060-927082 CAGGTGAGCGGGAAGGGGTGCGG - Intronic
968754018 4:2405593-2405615 TAGGTCAGAGGGAAGGGGCCGGG + Intronic
968864490 4:3199108-3199130 CAGCTCCTGGAGAAGGAGTCAGG - Intronic
968961216 4:3744584-3744606 CAGGACCGGGAGAAGGGGTCTGG + Intergenic
968976981 4:3827293-3827315 CAGGTGAGGGACAGGGGCTCGGG - Intergenic
969495890 4:7525950-7525972 CAGGTGACTGAGAAGGGGACAGG - Intronic
969508923 4:7606029-7606051 CACGTCAGGGAGAGGTGCTCTGG + Intronic
970356268 4:15256293-15256315 CAGGTCAAGGAGAAGGAATGAGG - Intergenic
971485591 4:27156827-27156849 CAGGTCAGTGGGAAGGGGAATGG - Intergenic
972136446 4:35900391-35900413 CAAGTCAGCAAGAAGGGGTCAGG + Intergenic
972282363 4:37615004-37615026 CACGGCTGGGAGTAGGGGTCTGG - Intronic
972311868 4:37890369-37890391 AAGGACGGGGAGAAGGGGTAAGG + Intergenic
973878592 4:55246188-55246210 CAGGTCATGGACAATGGTTCAGG - Intergenic
975283853 4:72594412-72594434 CTGCTCAGGGATCAGGGGTCAGG - Intergenic
980285437 4:130773147-130773169 CAGGGAAGGGAGATGGGGTGGGG - Intergenic
980575961 4:134683247-134683269 CAGGGAAGGGAGATGGGGTGGGG + Intergenic
980841231 4:138264155-138264177 CAGGGAAGGGAGAGGGGGTGAGG - Intergenic
982715187 4:158799490-158799512 CAAGTAAGGTAGAAGGTGTCTGG - Intronic
983779506 4:171650864-171650886 CAGGTCATGCACAAGGGCTCAGG - Intergenic
985727358 5:1523396-1523418 CGGTTCAGGGTGCAGGGGTCTGG + Intronic
986305298 5:6509715-6509737 CAGGGCAGGGCAAGGGGGTCCGG - Intergenic
987317592 5:16738298-16738320 CAGGCCTGGGAGCAGGGGTGGGG + Intronic
988255178 5:28810225-28810247 CAGGACAAAGAGAAGGCGTCGGG + Intergenic
988547765 5:32174192-32174214 CAGGTCAGGGCGAAGCGGGCTGG + Exonic
988690731 5:33569304-33569326 CTGCTCAGGGAACAGGGGTCAGG - Intronic
989467882 5:41778432-41778454 CAGTTTAGAGAGAAGAGGTCTGG + Intronic
989524977 5:42442886-42442908 AATGTCAGGGAGAATGAGTCAGG - Intronic
990974084 5:61542108-61542130 AAGGTTAGGGGTAAGGGGTCAGG - Intronic
992755661 5:79902995-79903017 CTGCTCAGGGATCAGGGGTCAGG - Intergenic
992786316 5:80173738-80173760 CAGGTGAGGGAGGAGTAGTCTGG - Intronic
994156287 5:96507209-96507231 CACGTCGGGGAGAAGAGGTTGGG + Intergenic
994775490 5:104032655-104032677 AAGGTGAAGGAGAAGGGGTTGGG - Intergenic
995681642 5:114727123-114727145 AAGGTCAGGGTGAAGTGGTGAGG - Intergenic
996686100 5:126282675-126282697 CAGGTCAGGTAAAAGGTCTCAGG - Intergenic
997382101 5:133445418-133445440 CAGGCCAGGGAGTGTGGGTCTGG + Intronic
997590101 5:135067128-135067150 CATGCCAGGGAGGAGGGGTCGGG - Intronic
998173477 5:139885972-139885994 TAGGGCAGTGAGAAGGGGTGGGG + Intronic
998246990 5:140515624-140515646 GGGGTCAGGGATCAGGGGTCAGG - Intronic
1000731511 5:164839733-164839755 CAGCCCAGGAAGAAGTGGTCAGG - Intergenic
1001592525 5:172875377-172875399 CAGGACAGGAAGATGGGGTTGGG + Intronic
1001922041 5:175608506-175608528 CAGCTCTGGGAGAGGGGGCCTGG - Intergenic
1002185590 5:177453455-177453477 CAGGCCCAGGAGAAGGGGACTGG + Intronic
1002661030 5:180791271-180791293 CAGGTCAGGGAGAAGGGGTCTGG + Exonic
1003044749 6:2723671-2723693 GAGCTCAGGTAGAAGTGGTCGGG + Intronic
1003343971 6:5248257-5248279 CAGCACAGGGAGAAGGGGACTGG - Intronic
1003411200 6:5864226-5864248 GAGGTCAGGAGGAAGGGGTGGGG + Intergenic
1003486521 6:6584905-6584927 AAGGTCAGGGAAAGGGGGTTTGG - Intergenic
1004603515 6:17173423-17173445 CAGGCAAGGGAGAAGGGGAAGGG + Intergenic
1005819591 6:29586881-29586903 CAGGTCAGAGACAAGGACTCAGG - Intronic
1006514746 6:34539566-34539588 CAGGGCAAGGAGAGGGGGTTGGG + Intronic
1006780306 6:36627869-36627891 CAAGGCAGGGACAAGGGGTTAGG + Intergenic
1006913468 6:37579221-37579243 GAGGTCAGGGATGGGGGGTCTGG - Intergenic
1007627343 6:43253957-43253979 CAGGTCAGGGGCAAGGGATAAGG - Intronic
1007716474 6:43858983-43859005 AAGGTCAGGGGTCAGGGGTCAGG - Intergenic
1008048841 6:46879472-46879494 CAGGAGAGGGAGAGAGGGTCTGG - Intronic
1008977537 6:57445573-57445595 CAGGGCAGTGAGAAAGGGTTGGG - Intronic
1009165677 6:60338527-60338549 CAGGGCAGTGAGAAAGGGTTGGG - Intergenic
1011379955 6:86732088-86732110 CTGCTCAGGGATCAGGGGTCAGG - Intergenic
1013437570 6:110126831-110126853 CAGATTAGGGAGAAGGAGACAGG - Intronic
1014145752 6:117996489-117996511 CTGCTCAGGGATCAGGGGTCAGG - Intronic
1014653827 6:124074244-124074266 CATGCCAGGCAGAAGGTGTCGGG - Intronic
1015045711 6:128774077-128774099 CAGGAGTGGGTGAAGGGGTCAGG - Intergenic
1015196251 6:130527394-130527416 CAGGCTTGGGAGAAGGGGCCAGG - Intergenic
1015357709 6:132298524-132298546 CAGATCAGCCAGCAGGGGTCAGG - Intronic
1017710128 6:157160196-157160218 CAGGTCAGGAAGCAGAGGTTTGG - Intronic
1018216598 6:161534117-161534139 CAGGACAGGGAAAGGGAGTCTGG - Intronic
1018540620 6:164875655-164875677 CAGGTCAGGGAACACAGGTCAGG - Intergenic
1018623042 6:165750376-165750398 CAGCTCAGGGAGCAGGAGTCTGG + Intronic
1019167446 6:170108209-170108231 CTGGTCAGGCTCAAGGGGTCTGG - Intergenic
1019178564 6:170173607-170173629 CAGGTCAGGGAAGGGGGCTCAGG - Intergenic
1019181135 6:170187841-170187863 CAGCTCAGGGACAAGGGGCCCGG - Intergenic
1019192287 6:170259342-170259364 CAGGGCAGGGAGGAGGTGCCAGG - Intergenic
1019447876 7:1080926-1080948 AAGGTCGGGGAGAAGGTGCCAGG + Intronic
1019543024 7:1559951-1559973 CAGGTCAGGGAGGCCGGGCCAGG + Intronic
1019749294 7:2718743-2718765 GTGGTCAGGGAGAAGCGGGCAGG + Intronic
1020115844 7:5475935-5475957 CAGGTCAGCGGGACGGGGACAGG + Intronic
1021146345 7:17093805-17093827 CAGCTTGGGGAGAAGGGGTAGGG - Intergenic
1021927362 7:25546250-25546272 CAGGGCAAGGAGGAGGGGTTGGG + Intergenic
1022923511 7:35038004-35038026 CGGGGCAGGGAGAAGGCGCCCGG + Exonic
1023093003 7:36633635-36633657 CAGGACGGGGAGCAGGGGCCTGG + Intronic
1023494408 7:40779031-40779053 CAGATCAGGCAGAATGGCTCAGG + Intronic
1023821471 7:43983016-43983038 GAGGTCAGGGAGGAGGGCGCTGG - Intergenic
1023870023 7:44258163-44258185 TAGCTCAGTGAGAAGGTGTCTGG - Intronic
1024056121 7:45660763-45660785 CAGGTGAGGGTGCAGGGCTCAGG + Intronic
1024056126 7:45660782-45660804 CAGGTGAGGGTGCAGGGCTCAGG + Intronic
1025115090 7:56250844-56250866 GAGGTGAGGGTGGAGGGGTCTGG + Intergenic
1026139961 7:67697516-67697538 CAGGGCAGCGAGCAGGGGTTAGG + Intergenic
1026457037 7:70581653-70581675 TTGGATAGGGAGAAGGGGTCAGG - Intronic
1026519886 7:71107475-71107497 GAGGTAAGGGGGAAGGGGTGTGG - Intergenic
1028589309 7:92479298-92479320 CAGCTAAGGGAGATGGGGTGGGG + Intergenic
1029115940 7:98237110-98237132 GAGGTCAGGGAGACGGGACCAGG - Intronic
1029310922 7:99663375-99663397 CAGGTCAGGGAGACAGGACCAGG - Intronic
1029530529 7:101122299-101122321 GAGGTCAGAGAGAAGGGAGCAGG + Intergenic
1029749734 7:102536437-102536459 GAGGTCAGGGAGGAGGGCGCTGG - Intergenic
1029767684 7:102635542-102635564 GAGGTCAGGGAGGAGGGCGCTGG - Intronic
1030089895 7:105849351-105849373 CAGGTCTGTCAGAAGGGATCTGG - Intronic
1030963794 7:115962999-115963021 CTGGTCGGGGAGAGGGGGACTGG - Intronic
1032019640 7:128400216-128400238 CAGGTGAGAGAGAAGGAGCCAGG + Intronic
1032429534 7:131849572-131849594 CAGCTCAGGGACAAGGGGAAAGG + Intergenic
1032888185 7:136164696-136164718 CAGGCCAGGGAGCAGTGGTGCGG - Intergenic
1033310679 7:140259807-140259829 GAGGTCAGGGAGAAGGGACAAGG + Intergenic
1033511305 7:142062865-142062887 CAGGTCTGGTAGAAGGTGTGAGG - Intronic
1033514422 7:142092210-142092232 CAGGTCTGGTAGAAGGTGTGAGG - Intronic
1034073903 7:148213738-148213760 CAGGGGAGGGAGGAGGAGTCAGG - Intronic
1034255923 7:149724665-149724687 CAGGATGGGGAGGAGGGGTCAGG - Exonic
1034471806 7:151258744-151258766 CAGGGCAGAGAGAAGGTGGCGGG - Intronic
1034496976 7:151428886-151428908 CAGATTAGGGAGCAGGGGGCTGG + Intronic
1035310865 7:157967827-157967849 GAATCCAGGGAGAAGGGGTCTGG + Intronic
1035476501 7:159147885-159147907 CATGACAGGGAGAGGGGGTTGGG + Intergenic
1036404582 8:8443095-8443117 CCGGTCAGGGCAATGGGGTCAGG + Intergenic
1036621015 8:10424591-10424613 AGGGACAGGGAGAAGGGGCCAGG + Intronic
1036684374 8:10899472-10899494 CAGGTCAGGGAGAAGCTAACTGG - Intronic
1037451982 8:19024698-19024720 CAGGAAGGGGAGAGGGGGTCTGG + Intronic
1037737286 8:21577894-21577916 CAGGTCGGGGAGACGGGAGCTGG - Intergenic
1037814215 8:22103329-22103351 CAGGCCAGTGAGATGGGGCCTGG + Exonic
1037928462 8:22863609-22863631 CAGAGCAGTGAGAAGGGGTGGGG - Intronic
1037992597 8:23331322-23331344 CAGAGGAGGGAGAAGGGCTCTGG - Intronic
1039783756 8:40813989-40814011 GAGGTCGGGGAGCAGGGGGCTGG + Intronic
1041289421 8:56294625-56294647 CAGGGCAGTGAGAAGGGAGCAGG + Intergenic
1041309733 8:56503162-56503184 CAGGGAAAGGAGATGGGGTCTGG + Intergenic
1041318934 8:56593818-56593840 TAGGTTAGGGAGAAGGGGGTTGG + Intergenic
1041554873 8:59142155-59142177 CAGGTCTTAGAGCAGGGGTCTGG + Intergenic
1042039600 8:64577993-64578015 GAGGTCGTGGAGATGGGGTCGGG + Intergenic
1042391541 8:68241330-68241352 CAGATTAGGGAGAAGGAGACAGG + Intergenic
1045698159 8:104834761-104834783 CAGATCGGGGATAAGGGGTTGGG - Intronic
1045718270 8:105074454-105074476 CAGGCCAGAGTGAAGGGGTCAGG + Intronic
1046739430 8:117812608-117812630 CAGGCCTGGGAGGAGGGGTGAGG + Intronic
1049277862 8:141728910-141728932 CACGTCAGGGAGAATTGGTCAGG + Intergenic
1049422518 8:142523253-142523275 CCGGGTAGGGAGAAAGGGTCTGG + Intronic
1049542260 8:143213968-143213990 CAGATCAGGCAGCAGGGCTCTGG - Intergenic
1049642364 8:143721450-143721472 CAGCACAGGCAGAAGGGGCCCGG - Intronic
1050538357 9:6649179-6649201 TAGGTATGGGAGAAGGGGTGAGG - Intergenic
1051602507 9:18889475-18889497 CAGGGCAGGGAGAAGGTGACAGG - Intronic
1051952919 9:22658627-22658649 CAGGGAAGGGAGATGGGGTGGGG + Intergenic
1052020553 9:23520677-23520699 CCTGTCAGGGAGTAGGGGGCTGG + Intergenic
1052395736 9:27935779-27935801 AAGGTCAGGGAGAAAGGGTTAGG - Intergenic
1056484019 9:87035994-87036016 CAGTTCAGGGTGAATGTGTCGGG - Intergenic
1056791910 9:89631457-89631479 CAGGACAGGGAGGAGGTGCCTGG + Intergenic
1057525501 9:95796050-95796072 CAGGTCAGGGGGAACTGGTCAGG - Intergenic
1057813242 9:98273922-98273944 CAGTGCAGGGAGATGGGGTGGGG + Intergenic
1058462751 9:105198126-105198148 GAGGTCAGGGAGGAGGGGAATGG + Intergenic
1058706165 9:107639578-107639600 CAGGGGAGGGAGGAGGGTTCAGG - Intergenic
1059715237 9:116907240-116907262 CAGGCCAGGGAAAAGGGAACGGG - Intronic
1061014973 9:127976285-127976307 CAGGTGAGGAAGCTGGGGTCAGG - Intronic
1061413024 9:130431238-130431260 CAGGACAGGGAGAAGGAGCAGGG + Intronic
1061920823 9:133781466-133781488 CAGCTCAGTGGGCAGGGGTCAGG + Intronic
1062121723 9:134837406-134837428 CAGATTAGGGAGCAGGGGTCTGG - Intronic
1062448838 9:136607133-136607155 CAGGCCCGGGAGAAAGGGCCCGG - Intergenic
1062460566 9:136660991-136661013 CAGGTGGGGGAGGAGGGGGCAGG + Intronic
1062538332 9:137030575-137030597 GAGGTCAGGAAGCAGGGGTGGGG - Exonic
1062655775 9:137604218-137604240 CAGGTCAGGGAGGAGGAGTCTGG - Intergenic
1186490944 X:9971562-9971584 CAGGACAGGGAGTAAGGGTAGGG - Intergenic
1186846292 X:13534204-13534226 CAAGTGAGGGAGAAGGGGAAGGG + Intergenic
1186905767 X:14109255-14109277 CTGCTCAGGGATCAGGGGTCAGG + Intergenic
1187272529 X:17792074-17792096 GAGGTCAGGGAGATGAGGCCTGG + Intergenic
1187477476 X:19625037-19625059 CAGTTCAGAGAGAAAGGGTCAGG + Intronic
1188438836 X:30194146-30194168 CAGGAAAGGGAGATGGGGTGGGG - Intergenic
1189982826 X:46528306-46528328 CAGGCCAGGGAAAAGGGACCAGG - Intronic
1190752599 X:53375253-53375275 CAGGACAGGCAGAGGTGGTCAGG - Exonic
1190817457 X:53940614-53940636 CAGGTAAGGGAGAGGGTGGCAGG - Intronic
1192031204 X:67514307-67514329 CCTGTCAGGGAGAGGGGGGCTGG + Intergenic
1192202062 X:69072735-69072757 GAGGACAGGAAGAAGGGGTGAGG + Intergenic
1192343098 X:70280377-70280399 CTGGTCTGGGAGAAAGGGTGGGG - Intronic
1192705804 X:73528000-73528022 CAGGGAAGGGAGATGGGGTGGGG - Intergenic
1193399656 X:81027536-81027558 CTGCTCAGGGATCAGGGGTCAGG - Intergenic
1193600490 X:83504254-83504276 CAGGACAGGGAGTAGCGGTGGGG - Intergenic
1193601806 X:83515807-83515829 CATGTCTGTGAAAAGGGGTCAGG - Intergenic
1193906629 X:87253047-87253069 CAGATCAGGATGAAGAGGTCAGG - Intergenic
1194696788 X:97062515-97062537 AAGGACAGGGAGATGGTGTCAGG + Intronic
1196645802 X:118116649-118116671 CAGGACAGGGTGAAGTGGTCGGG - Intronic
1197089905 X:122523831-122523853 CAGCCCTGGGAGAAGTGGTCAGG - Intergenic
1197492194 X:127131006-127131028 CATTTCTGGGAGAATGGGTCTGG - Intergenic
1197618681 X:128722253-128722275 CAGGGCAGGGCAAAGTGGTCAGG + Intergenic
1197698775 X:129580387-129580409 CTGGTTAGGGAGAATGGGGCAGG + Intronic
1197824320 X:130572977-130572999 CTGCTCAGGGATCAGGGGTCAGG + Intergenic
1199523883 X:148769763-148769785 CAAGTTAAGGAGAAGGGGTCTGG - Intronic
1200110420 X:153738027-153738049 CATGCCAGGGAGGAGGGGGCCGG + Intronic
1201413306 Y:13722646-13722668 CTGCTCAGGGATCAGGGGTCAGG - Intergenic