ID: 1002662732

View in Genome Browser
Species Human (GRCh38)
Location 5:180802708-180802730
Sequence CTTGGCCTGCTCCGGGGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 180}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002662718_1002662732 14 Left 1002662718 5:180802671-180802693 CCTACTCACCAGGTCCTCCCGAC 0: 1
1: 0
2: 2
3: 17
4: 161
Right 1002662732 5:180802708-180802730 CTTGGCCTGCTCCGGGGCGCAGG 0: 1
1: 0
2: 0
3: 15
4: 180
1002662712_1002662732 30 Left 1002662712 5:180802655-180802677 CCTCCGTCCCCGGACACCTACTC 0: 1
1: 0
2: 1
3: 17
4: 236
Right 1002662732 5:180802708-180802730 CTTGGCCTGCTCCGGGGCGCAGG 0: 1
1: 0
2: 0
3: 15
4: 180
1002662717_1002662732 21 Left 1002662717 5:180802664-180802686 CCGGACACCTACTCACCAGGTCC 0: 1
1: 0
2: 0
3: 15
4: 165
Right 1002662732 5:180802708-180802730 CTTGGCCTGCTCCGGGGCGCAGG 0: 1
1: 0
2: 0
3: 15
4: 180
1002662716_1002662732 22 Left 1002662716 5:180802663-180802685 CCCGGACACCTACTCACCAGGTC 0: 1
1: 0
2: 1
3: 20
4: 146
Right 1002662732 5:180802708-180802730 CTTGGCCTGCTCCGGGGCGCAGG 0: 1
1: 0
2: 0
3: 15
4: 180
1002662721_1002662732 0 Left 1002662721 5:180802685-180802707 CCTCCCGACGTCCTGGCCCCGAA 0: 1
1: 0
2: 0
3: 6
4: 62
Right 1002662732 5:180802708-180802730 CTTGGCCTGCTCCGGGGCGCAGG 0: 1
1: 0
2: 0
3: 15
4: 180
1002662715_1002662732 23 Left 1002662715 5:180802662-180802684 CCCCGGACACCTACTCACCAGGT 0: 1
1: 0
2: 3
3: 4
4: 85
Right 1002662732 5:180802708-180802730 CTTGGCCTGCTCCGGGGCGCAGG 0: 1
1: 0
2: 0
3: 15
4: 180
1002662713_1002662732 27 Left 1002662713 5:180802658-180802680 CCGTCCCCGGACACCTACTCACC 0: 1
1: 0
2: 0
3: 11
4: 236
Right 1002662732 5:180802708-180802730 CTTGGCCTGCTCCGGGGCGCAGG 0: 1
1: 0
2: 0
3: 15
4: 180
1002662720_1002662732 6 Left 1002662720 5:180802679-180802701 CCAGGTCCTCCCGACGTCCTGGC 0: 1
1: 0
2: 2
3: 18
4: 600
Right 1002662732 5:180802708-180802730 CTTGGCCTGCTCCGGGGCGCAGG 0: 1
1: 0
2: 0
3: 15
4: 180
1002662722_1002662732 -3 Left 1002662722 5:180802688-180802710 CCCGACGTCCTGGCCCCGAACTT 0: 1
1: 0
2: 1
3: 2
4: 54
Right 1002662732 5:180802708-180802730 CTTGGCCTGCTCCGGGGCGCAGG 0: 1
1: 0
2: 0
3: 15
4: 180
1002662723_1002662732 -4 Left 1002662723 5:180802689-180802711 CCGACGTCCTGGCCCCGAACTTG 0: 1
1: 0
2: 0
3: 3
4: 72
Right 1002662732 5:180802708-180802730 CTTGGCCTGCTCCGGGGCGCAGG 0: 1
1: 0
2: 0
3: 15
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002662732 Original CRISPR CTTGGCCTGCTCCGGGGCGC AGG Intronic
900376923 1:2359124-2359146 CTTGGGCTGGTCAGGGGCGTGGG + Intronic
900382343 1:2391233-2391255 CTTGGCCTGCTGCGGGAGGAGGG + Intronic
900386450 1:2413064-2413086 GTTGGCCAGTTCCGGGGAGCCGG + Intronic
900422081 1:2560064-2560086 CATGGCCTGCCCAGGGGCCCTGG + Intronic
903483302 1:23670308-23670330 CTTCACATGCTCCGGGGTGCTGG + Intergenic
903741597 1:25561787-25561809 TTTGGCCTGCTCCCGAGGGCAGG + Intronic
903831989 1:26180937-26180959 CTTGGCCTCCTTCAGGGCGTGGG + Intronic
903935118 1:26890103-26890125 GTTGACCTGCTCCGGGCCGCGGG - Exonic
905733573 1:40311955-40311977 CTGGGCCTGCTCCTGGCCACTGG - Intronic
906202574 1:43969777-43969799 CCTGGCCTCCTCTCGGGCGCTGG - Intergenic
906960856 1:50418871-50418893 CCTGGCCTACTCCGCGGCGGCGG - Exonic
907430291 1:54407132-54407154 CTTGGCGTGCTTTGGGGAGCCGG + Intronic
914386169 1:147172238-147172260 CTTGCCCTGTCCCGAGGCGCAGG - Intronic
916070800 1:161168555-161168577 CTGGGCCTGCTGCTGGGGGCAGG + Exonic
916773443 1:167936192-167936214 ATTGGCCCGCCCCGAGGCGCGGG + Intronic
918423660 1:184387381-184387403 CATTGCCTGCTCTGGGGCGGGGG + Intronic
922648537 1:227317795-227317817 CTTGGCGTGCTCCGAGCCGAGGG - Exonic
924387034 1:243508597-243508619 CCTGCCCTGCTCCTGGGCCCTGG - Intronic
1063142526 10:3268095-3268117 CTTGGCCTGATCGGGGACACTGG + Intergenic
1064028750 10:11869823-11869845 CTTGGGCTGCGCCGGGTGGCTGG - Exonic
1070784974 10:79157633-79157655 CTTGGCCTGCACCCTGGCCCAGG + Intronic
1070912782 10:80132793-80132815 CTGGCCCTGCTCCGCGCCGCGGG + Exonic
1071937692 10:90549319-90549341 CTTGGCCTGTTCCTGGGCTTTGG + Intergenic
1072408982 10:95183546-95183568 CCTCGCCTCCTCCGGGCCGCGGG + Intergenic
1072935072 10:99704305-99704327 CTTTGCCTGCTCTGTGGAGCTGG + Intronic
1076683745 10:132187527-132187549 CCCGGGCTGGTCCGGGGCGCGGG + Intronic
1076806108 10:132859656-132859678 CTGTGGCTGCTCCGGGGCGGCGG - Intronic
1076827318 10:132975526-132975548 CTTGGGCTGTTCCGGGCCCCAGG + Intergenic
1077464272 11:2726172-2726194 CTTGGCCTGCTCCTCTGCCCTGG - Intronic
1079952303 11:26820048-26820070 CTTGGCCTCCTCCAAGGTGCTGG + Intergenic
1080178483 11:29394836-29394858 GGTGGCCTGCTCCTGGGCTCAGG + Intergenic
1083269979 11:61567340-61567362 CTTGGACAGCTCTGGGGGGCGGG - Intronic
1083409128 11:62479926-62479948 CTTGGCCCATTCCGGGGAGCTGG + Intronic
1083745379 11:64733306-64733328 CTGGGCCTGGTCCTGGGAGCCGG + Intronic
1083890207 11:65592199-65592221 CTCGTCCTCCTCCAGGGCGCTGG - Exonic
1085316398 11:75547834-75547856 CTTTGTCTGCTCCAGGGCCCTGG - Intergenic
1089537310 11:119168792-119168814 CTGCGCCTGCTCCGGAGCACCGG + Exonic
1089593568 11:119560478-119560500 CCTGGCCTGCCCCAGGGCTCAGG - Intergenic
1202808455 11_KI270721v1_random:17280-17302 CTTGGCCTGGGCTGGGGCTCGGG + Intergenic
1091550095 12:1530416-1530438 CGCGCCCTGCTCCGGAGCGCGGG - Intronic
1093736451 12:22625456-22625478 CTTGGGCACCTCCGGGGAGCCGG - Exonic
1094375454 12:29783908-29783930 CTGGGCCAACTCCGCGGCGCAGG - Intronic
1096288715 12:50322978-50323000 CTTGGCCTGCTACTGGGCTTTGG + Intergenic
1099508564 12:83507205-83507227 CTTGGCCTGCTACTGGGCTTCGG + Intergenic
1103415838 12:120741084-120741106 CTGGGCCTGGTCCAGGGCCCCGG + Intergenic
1103951505 12:124554049-124554071 TTTGGCCTGCCCCGGGGCCCTGG - Intronic
1104289650 12:127455843-127455865 CTGGGGCGGCTGCGGGGCGCGGG + Intergenic
1104949240 12:132431580-132431602 CTTGGCCTGCTCCGGGCTCTGGG + Intergenic
1107359362 13:39602781-39602803 GTTGGGCTGCTCCCGGGCTCCGG - Intronic
1112428065 13:99323044-99323066 CCTGGCCTGCTTCTGGGCGAGGG + Intronic
1114209303 14:20601745-20601767 CTTGGCTTGGTGGGGGGCGCCGG + Intronic
1115143402 14:30199405-30199427 CTTGGCCTGCTACTGGGCTTTGG + Intergenic
1118725782 14:68628297-68628319 CTCGGGCCGCCCCGGGGCGCGGG + Intronic
1119768516 14:77205775-77205797 CCTGGCCTGCTCCTGGGCAGAGG - Intronic
1120763653 14:88308419-88308441 CTTGGCCTTCTCTGGGCTGCTGG - Intronic
1122582146 14:102777636-102777658 CTCGGCCGGCTCAGGGGCGCCGG - Exonic
1122798952 14:104220444-104220466 CTGGGCCTCCTGCGGGGCGGGGG - Intergenic
1132408048 15:101556510-101556532 CAAAGCCTGCTCCGGAGCGCCGG + Intergenic
1132515166 16:362810-362832 CTTGGCATGGGCCTGGGCGCCGG + Intergenic
1132719508 16:1308980-1309002 CTGGCCCTGGGCCGGGGCGCGGG - Exonic
1132803412 16:1764996-1765018 CTTGGCCTGTTTCAGGGCACGGG - Exonic
1132806151 16:1776052-1776074 CTTTGCCTGCTCCTAGGCGCTGG + Exonic
1133315801 16:4883282-4883304 CTTGGCCTGCACCAGGGCAAGGG + Exonic
1135035793 16:19075755-19075777 CATGGCCTGCACCGTGGCGGTGG + Exonic
1137652808 16:50134930-50134952 CTTGGCCTGCTCCTGAGCCTTGG - Intergenic
1137673035 16:50290585-50290607 CTGGGCCTGCTTGGTGGCGCTGG + Exonic
1138265306 16:55656086-55656108 CTTGGCAGGCTCTAGGGCGCGGG - Intronic
1138599793 16:58047617-58047639 CCTGGCCTGCTCCGTGGTGGGGG - Intergenic
1138889822 16:61128787-61128809 CCTCCCCTGCTCCGTGGCGCCGG - Intergenic
1139465045 16:67149998-67150020 CTGGGCGTGCCCAGGGGCGCAGG - Exonic
1139539030 16:67599974-67599996 CTTGGTGTGCTCAGGGGGGCTGG + Intronic
1141149350 16:81553272-81553294 CATGGCCTGCTCCAGTGCCCAGG - Intronic
1141283937 16:82653795-82653817 TTGTGCCTGCACCGGGGCGCAGG + Intronic
1141418940 16:83899242-83899264 CATGGCCCGCTCCAGGGCGCCGG - Exonic
1142695377 17:1629922-1629944 CCTGGCTCGCTCCGGGGGGCTGG + Intergenic
1143524300 17:7463308-7463330 CTTGGCCTCCTCCGTGGTGGTGG + Exonic
1149568733 17:57657307-57657329 CTTGGCCTGCATGGGGGTGCGGG + Intronic
1150295477 17:64005137-64005159 CTTCACCTGCTCCGGGAAGCAGG - Exonic
1150929982 17:69573914-69573936 CTTGTACTGCTCCGGGTTGCAGG + Intergenic
1151492852 17:74443111-74443133 CAAGGCCTGCTCCGAGGCCCCGG + Intronic
1151660725 17:75516677-75516699 CCTGGCCGGGTCCCGGGCGCCGG - Intronic
1152555247 17:81049811-81049833 CTTGGCCTGATTAGGGGAGCCGG + Intronic
1153916515 18:9750444-9750466 CTTGGCATGCACTGGGGCCCTGG + Intronic
1154129532 18:11724810-11724832 CTTGGCCTGCTCCTGGGCCTTGG - Intronic
1157867118 18:51197006-51197028 CTCGGCCGCCTCCGGGGCCCCGG + Exonic
1160092466 18:75840029-75840051 CTTGGCCTGTTACTGGGCTCTGG + Intergenic
1160943451 19:1630560-1630582 CTGGACCTGCTGCGGGGCCCAGG - Intronic
1161022470 19:2016463-2016485 GCGGGCCTGCTCCGTGGCGCAGG + Intronic
1161063708 19:2227538-2227560 CTGGGGCTGCTGCGGGGCGGGGG + Intronic
1161879390 19:6937279-6937301 CCTGGGCTGCTCCTGGGTGCTGG + Exonic
1162567127 19:11450756-11450778 CGTGCCCTGCTCTGGGGCCCAGG + Exonic
1162998766 19:14352779-14352801 CTTGCCCTGCTCCGGCCCTCTGG - Intergenic
1164400168 19:27896634-27896656 CTTGGCCTCCTCCGAGAGGCCGG + Intergenic
1167002996 19:46756809-46756831 CTTTGCCGGCTTCGTGGCGCAGG + Exonic
1167004562 19:46767143-46767165 CTGGGCCTGCTGAGGGGTGCAGG - Intronic
1167125299 19:47545014-47545036 CTTGACCTTCTTGGGGGCGCAGG + Exonic
1167306863 19:48714594-48714616 CTGGGCGGGCTCCCGGGCGCAGG + Intronic
1167792073 19:51689237-51689259 CTGGGCCAGCTCCGGGGCAGGGG + Intergenic
925068852 2:950852-950874 CTCGGGCTCCACCGGGGCGCAGG - Exonic
926112797 2:10193548-10193570 CCTGTCCTGCTCAGGGGCGGAGG + Intronic
934978545 2:98822650-98822672 CTTGGGGCGCTCCGGGGCGGCGG + Exonic
935944627 2:108274349-108274371 CTTGGCCTGCTACTGGGCCTAGG - Intergenic
937245438 2:120489320-120489342 CTTGCCCTGCTCTGGGCCCCAGG - Intergenic
938993362 2:136652541-136652563 CTTGGCCTCCTCCTGAGAGCTGG - Intergenic
941111714 2:161423971-161423993 CTTGGCGTCCTCGGCGGCGCCGG - Exonic
943385881 2:187203234-187203256 CTTGGCCTGCTACTGGGCTTTGG - Intergenic
946397050 2:219448456-219448478 CTTGGGCTGCTCCAGAGAGCGGG - Exonic
947840482 2:233204485-233204507 CTTGGCCGGCACCGGGGCCTGGG - Exonic
948050309 2:234974982-234975004 CTTGGCCTGCTCCGAGGGACGGG - Intronic
948569624 2:238909621-238909643 CTTGGCCTGGCCCAGGGGGCAGG + Intronic
948654261 2:239466814-239466836 CCTGGCCTACTCTGGGGGGCGGG + Intergenic
1169076156 20:2760789-2760811 CTGGCCCTGCTCCTGGGCTCTGG + Intergenic
1173667429 20:44772833-44772855 CTTGCCCTGCTCCTGTACGCAGG - Intronic
1174619363 20:51862450-51862472 CTTGGCCTGGCCAGGGGCGGTGG + Intergenic
1175108465 20:56630229-56630251 CTAGGCGAGCTCAGGGGCGCCGG + Intronic
1176514498 21:7774016-7774038 CTTGGCCTGTCCCGGGGTGGTGG - Intergenic
1178648611 21:34404540-34404562 CTTGGCCTGTCCCGGGGTGGTGG - Intronic
1179133799 21:38661574-38661596 CTTGTCCGCCTCCGGGGCTCGGG + Intronic
1180095797 21:45554984-45555006 CTGGACGTGCTCCTGGGCGCGGG - Intergenic
1180177890 21:46098869-46098891 CTGGGACTCCGCCGGGGCGCTGG + Intronic
1181085659 22:20438214-20438236 CTTGGCCGGTTCCGAGGCGCTGG - Intronic
1182419908 22:30243957-30243979 CTTGGCCTTCTCCGTGCCGTTGG + Exonic
1183425105 22:37735023-37735045 CTTGGCCTTCTCCGGGCACCAGG + Exonic
1184091022 22:42293081-42293103 CTTGGCCTCCTCCTGGGCTTGGG - Intronic
1185072319 22:48663050-48663072 CTTGGGATGCTCCGGGACGCAGG + Intronic
1185312174 22:50162221-50162243 GTTGGCCTCCTCTGGGGCCCTGG - Intergenic
1185365974 22:50436902-50436924 CTGGGCATGGTCCTGGGCGCTGG + Intronic
1185388562 22:50547418-50547440 CTTTGCTTGCTCCGGGGGCCGGG - Intergenic
954609933 3:51939032-51939054 TTTGACCTGCTCCTGGGAGCTGG + Intronic
959997862 3:112698335-112698357 CTTGGCCTGCTACTGGGCTTTGG + Intergenic
961532172 3:127546683-127546705 CCTGGCCTTCTCTGGGACGCTGG - Intergenic
965363290 3:167766591-167766613 CTTGGCTTGCTCCTTGGCACAGG - Intronic
966091606 3:176144996-176145018 CTTGGCCTGCTCAGGAGCTCAGG + Intergenic
966592113 3:181695351-181695373 CGTGGGCTGCTCCGAGGCGCAGG - Intergenic
967271559 3:187737539-187737561 CTAGGCTTGCCCCGGCGCGCAGG - Intronic
968150874 3:196335692-196335714 CCTGTCCTGCTCCTGGGAGCAGG + Intronic
968509704 4:990169-990191 CTGAGCCTGCTGCGCGGCGCCGG - Exonic
968631768 4:1655568-1655590 CCAGGCCTGCGCCTGGGCGCGGG + Exonic
968965169 4:3766009-3766031 CTCCGGCTGCTCCCGGGCGCGGG - Intergenic
973118445 4:46489058-46489080 CTTGGCCTGTTACTGGGCTCTGG + Intergenic
984060281 4:174982009-174982031 CTTGGCCTGCTACTGGGCTTTGG - Intergenic
985593567 5:777775-777797 CTCCGCCTGCTGCGGGGCTCAGG - Intergenic
997589806 5:135065703-135065725 CTGGGCTTGCTCCGGGGCAAAGG + Intronic
1000325536 5:160169320-160169342 CTTGGCCTCTTCCTGGGCACAGG + Intergenic
1002071324 5:176680356-176680378 CTGGGCCGGCTCCCGGGCGCGGG + Intergenic
1002662732 5:180802708-180802730 CTTGGCCTGCTCCGGGGCGCAGG + Intronic
1003131131 6:3396265-3396287 CCTGGCCATCTCCGGGGCACAGG - Intronic
1007781620 6:44257659-44257681 CCTGGGCTGCCCCTGGGCGCGGG + Intronic
1009770331 6:68136835-68136857 CTTGGCCTGCTACTGGGCCTTGG - Intergenic
1010568594 6:77449904-77449926 CTTGGCCGGCTCTGGGGTCCGGG - Intergenic
1012977575 6:105796388-105796410 CATGGCCTGGTCCGAGGGGCCGG - Intergenic
1013391040 6:109686732-109686754 CTTGGCATGCTCTTGGGCTCTGG + Intronic
1015773592 6:136792483-136792505 CTTGAGCTGCACCGCGGCGCAGG - Exonic
1015786333 6:136923452-136923474 CCTGGCCCGCTCCGGGTTGCAGG + Intronic
1015966912 6:138703284-138703306 CTTGACCTCCTCCTGGGCTCAGG - Intergenic
1017873346 6:158503979-158504001 CTTGGCCTCCTCCAGCTCGCCGG - Exonic
1018960049 6:168441523-168441545 CTGGGCCTGGAGCGGGGCGCGGG - Intronic
1019381653 7:727289-727311 CGTGGCCTGCGCCAGGGCGGCGG - Exonic
1019919037 7:4151138-4151160 CTTGGACTGCTCAGGGACTCTGG - Intronic
1022632949 7:32102786-32102808 CATGGCCTGCTCTTGGGAGCAGG - Intronic
1024041772 7:45561531-45561553 CTTGGCATGCTCAAGGGCACAGG + Intergenic
1029038646 7:97549719-97549741 CTTGGGCTGCTCAGTGGCCCTGG - Intergenic
1031388754 7:121186980-121187002 CTGGGCCTGCCCCTGGGCTCTGG + Intronic
1035455669 7:159007024-159007046 CGTGGCCTGCTCAGGGGCCCGGG + Intergenic
1035588887 8:798279-798301 CCTGGCCAGCGCCGGGGCACGGG - Intergenic
1035588905 8:798363-798385 CCTGGCCAGCACCGGGGCACGGG - Intergenic
1035588937 8:798531-798553 CCTGGCCAGCGCCGGGGCACGGG - Intergenic
1035588953 8:798615-798637 CCTGGCCAGCACCGGGGCACGGG - Intergenic
1035588970 8:798699-798721 CCTGGCCAGCGCCGGGGCACGGG - Intergenic
1035971610 8:4255796-4255818 CATGGCCTCCTCTGGGGCACTGG + Intronic
1036162894 8:6406148-6406170 CCCTGCCTGCTCCGGGGAGCCGG - Intergenic
1038085604 8:24193114-24193136 CATGGACTGCTCCGTGGCCCAGG - Intergenic
1039493571 8:37965295-37965317 GCTGGGCTGCTCCGGGCCGCAGG + Exonic
1043463993 8:80487064-80487086 CTTGGCTTCCTCGGCGGCGCCGG - Exonic
1049599704 8:143501712-143501734 CATGCCCGGCCCCGGGGCGCTGG + Intronic
1049599723 8:143501781-143501803 CATGCCCGGCCCCGGGGCGCGGG + Intronic
1049774413 8:144397871-144397893 CTTGGACTGCTGCGGGGAGAGGG + Exonic
1049854447 8:144852749-144852771 CGTCGCCCGTTCCGGGGCGCGGG + Intronic
1053609336 9:39695258-39695280 CTTGCTCTGCTCCAGGGTGCCGG - Intergenic
1053867175 9:42451530-42451552 CTTGCTCTGCTCCAGGGTGCCGG - Intergenic
1054088979 9:60776230-60776252 CTTGCTCTGCTCCAGGGTGCCGG + Intergenic
1054244188 9:62647139-62647161 CTTGCTCTGCTCCAGGGTGCCGG + Intergenic
1054558313 9:66681687-66681709 CTTGCTCTGCTCCAGGGTGCCGG + Intergenic
1056507584 9:87271581-87271603 CCTGGCCTTCTCCTGGGCTCTGG - Intergenic
1060792657 9:126496789-126496811 CTTGCCCTGCTCCTGGACACAGG + Intronic
1061348018 9:130042661-130042683 CACGGCCCGCTCCGGGGCGCCGG + Intronic
1061765520 9:132878789-132878811 CTTGGCCAGAGCCGGGGAGCTGG - Intronic
1061818238 9:133208595-133208617 CTTGGCCTGCTCCAGATCACAGG - Exonic
1061848420 9:133400864-133400886 TTTTGCCTGCTCCGTGGCCCTGG + Intronic
1062242218 9:135546763-135546785 CTTGGCCTGCTCCAGATCACAGG + Exonic
1062508968 9:136894445-136894467 CTGGGCCTTGTCCTGGGCGCAGG + Intronic
1062532018 9:137006208-137006230 CCTGGCCTGGTCCTGCGCGCAGG + Intergenic
1186618650 X:11215066-11215088 CTGGGGCTGCTCCTGGGCCCTGG - Intronic
1198534498 X:137573745-137573767 CTTGGCCGGGGCCGGGGCGGAGG + Intronic
1199933928 X:152552997-152553019 CTTGGCTTGCTCTGGGGGCCAGG - Intergenic
1200098156 X:153673755-153673777 CTGCACCTGCTCCGGGGCGCGGG - Intronic