ID: 1002665247

View in Genome Browser
Species Human (GRCh38)
Location 5:180818522-180818544
Sequence GCCACAGTGAATTCCAACGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002665247_1002665248 -9 Left 1002665247 5:180818522-180818544 CCTACGTTGGAATTCACTGTGGC No data
Right 1002665248 5:180818536-180818558 CACTGTGGCACAGCTGTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002665247 Original CRISPR GCCACAGTGAATTCCAACGT AGG (reversed) Intergenic
No off target data available for this crispr