ID: 1002670302

View in Genome Browser
Species Human (GRCh38)
Location 5:180861205-180861227
Sequence GCGGACTCACGTACTGGCTG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 44}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002670298_1002670302 1 Left 1002670298 5:180861181-180861203 CCGGGGGCGGGAGCGCGGGCGGC 0: 1
1: 0
2: 7
3: 110
4: 597
Right 1002670302 5:180861205-180861227 GCGGACTCACGTACTGGCTGTGG 0: 1
1: 0
2: 0
3: 3
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002670302 Original CRISPR GCGGACTCACGTACTGGCTG TGG Exonic
901962791 1:12840746-12840768 GCTGACTCATGTCCTGGATGCGG - Intergenic
901989982 1:13105049-13105071 GCTGACTCATGTCCTGGATGTGG - Intergenic
904200403 1:28815723-28815745 GCCGGCTCATGTACTGGTTGTGG - Intronic
904437638 1:30508929-30508951 GCGGTCTCACAGCCTGGCTGGGG + Intergenic
904483144 1:30806624-30806646 GCTGCCCCACGTTCTGGCTGTGG + Intergenic
907441588 1:54481873-54481895 TTGGACTCAGGTACTGCCTGAGG + Intergenic
914876973 1:151519275-151519297 GAGGACTCAGGTTCTGGCTCTGG - Exonic
915564519 1:156706195-156706217 TCGGGCTCACGTAATGCCTGGGG + Intergenic
1068945725 10:62726822-62726844 GCTGACTCACTTACTTGTTGTGG + Intergenic
1074313112 10:112339441-112339463 CCAGACTCAAGTTCTGGCTGTGG + Intergenic
1086349878 11:85934862-85934884 GCGTCTTCACGTACTGGGTGGGG - Intergenic
1088546734 11:110966694-110966716 GCAGCCTCATATACTGGCTGGGG - Intergenic
1090383907 11:126345478-126345500 GCGGGCCCACCTGCTGGCTGAGG + Exonic
1110148310 13:72221099-72221121 GTGCATTCAGGTACTGGCTGTGG + Intergenic
1118992383 14:70808832-70808854 GCGGGGTCACGTAGTTGCTGGGG + Exonic
1123918737 15:25055915-25055937 GCGCCCTCACGTGCTGGTTGTGG + Intergenic
1131260334 15:90884467-90884489 GCGGAATCAGGAACTGGCCGGGG + Exonic
1133304552 16:4801257-4801279 GGGGACTCACCGCCTGGCTGAGG + Exonic
1136526519 16:30834703-30834725 GCGGCCTCAGGCACTGGATGTGG + Exonic
1139934196 16:70556268-70556290 GCGGTCTCGCTTCCTGGCTGTGG + Exonic
1145144412 17:20468494-20468516 GCAGACTCACGTATGGCCTGGGG - Intergenic
1145175858 17:20699897-20699919 GCAGACTCACGTATGGCCTGGGG - Intergenic
1150101096 17:62424171-62424193 GGGGCCTCACGTCCTGGCTGCGG - Intronic
1164587776 19:29487560-29487582 GCTGACTCCAGTGCTGGCTGAGG + Intergenic
1164835063 19:31350706-31350728 GCGGGCTCACTTACGGGCGGCGG + Intergenic
931128248 2:59301954-59301976 GGGGACTGACGTACTCACTGTGG - Intergenic
933684483 2:85132972-85132994 TCGGACGCACATACTGGCCGCGG - Intergenic
934737723 2:96698444-96698466 GGGAACTCACCTACTGACTGCGG + Intergenic
946089263 2:217206460-217206482 GAGGACTCACTTCCTGGCTCTGG - Intergenic
946707291 2:222470906-222470928 GCGGAATCATGAACTGCCTGAGG - Intronic
947126127 2:226870136-226870158 CCGGGCTCACATACTGGCCGTGG + Intronic
1168848389 20:960380-960402 GCGGCCTCACGTCCAGCCTGCGG + Exonic
1178768670 21:35481417-35481439 GCTGAGTCAGGTAGTGGCTGGGG - Intronic
1181457951 22:23070339-23070361 GCGGACCCGCGGACTGGCGGCGG + Exonic
959973997 3:112437566-112437588 GTTTCCTCACGTACTGGCTGTGG - Intergenic
960510594 3:118544595-118544617 GCTGACTCACGTCCTGGGTGTGG + Intergenic
971454725 4:26833762-26833784 GTGAACCCACCTACTGGCTGGGG - Intergenic
1002384361 5:178855235-178855257 GAGGACCCAGGTACTGGGTGGGG - Intergenic
1002670302 5:180861205-180861227 GCGGACTCACGTACTGGCTGTGG + Exonic
1017613193 6:156213518-156213540 GTGCACTCAGGTACTGGCTGTGG + Intergenic
1026956658 7:74380663-74380685 ACGGACTCAGGGACTTGCTGCGG - Intronic
1027358280 7:77381640-77381662 GGGGAGTCAAGTACTTGCTGAGG - Intronic
1033456941 7:141511507-141511529 GAGAACTCACGTGCTGGCTAGGG - Intergenic
1033810038 7:145001777-145001799 GTGCACACATGTACTGGCTGTGG + Intergenic
1056342659 9:85653036-85653058 GTGGACTCACATTCTAGCTGAGG + Intronic
1060898944 9:127240453-127240475 GCAGCCTCAGTTACTGGCTGAGG - Intronic
1187765330 X:22635394-22635416 GTCGACTCACGTTCTGGCTTAGG - Intergenic
1201951394 Y:19567864-19567886 TCGGTCTCACCGACTGGCTGCGG - Intergenic