ID: 1002671681

View in Genome Browser
Species Human (GRCh38)
Location 5:180872683-180872705
Sequence GAGGCTTTCGACTGTGGCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002671672_1002671681 -3 Left 1002671672 5:180872663-180872685 CCTGCCAGGACCAGCCGTGTGAG No data
Right 1002671681 5:180872683-180872705 GAGGCTTTCGACTGTGGCGGGGG No data
1002671671_1002671681 5 Left 1002671671 5:180872655-180872677 CCAGGACACCTGCCAGGACCAGC No data
Right 1002671681 5:180872683-180872705 GAGGCTTTCGACTGTGGCGGGGG No data
1002671669_1002671681 16 Left 1002671669 5:180872644-180872666 CCTGAGCACATCCAGGACACCTG No data
Right 1002671681 5:180872683-180872705 GAGGCTTTCGACTGTGGCGGGGG No data
1002671674_1002671681 -7 Left 1002671674 5:180872667-180872689 CCAGGACCAGCCGTGTGAGGCTT No data
Right 1002671681 5:180872683-180872705 GAGGCTTTCGACTGTGGCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002671681 Original CRISPR GAGGCTTTCGACTGTGGCGG GGG Intergenic
No off target data available for this crispr