ID: 1002679921

View in Genome Browser
Species Human (GRCh38)
Location 5:180953352-180953374
Sequence TTATAGATGCACATTGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002679918_1002679921 -8 Left 1002679918 5:180953337-180953359 CCATATCAGAGTGATTTATAGAT No data
Right 1002679921 5:180953352-180953374 TTATAGATGCACATTGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002679921 Original CRISPR TTATAGATGCACATTGAGGG AGG Intergenic
No off target data available for this crispr