ID: 1002680000

View in Genome Browser
Species Human (GRCh38)
Location 5:180954401-180954423
Sequence TGAAAACTAACTTGGTGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002680000_1002680006 27 Left 1002680000 5:180954401-180954423 CCCCACCACCAAGTTAGTTTTCA No data
Right 1002680006 5:180954451-180954473 GCAGCCACAGACAGGAACACCGG No data
1002680000_1002680007 28 Left 1002680000 5:180954401-180954423 CCCCACCACCAAGTTAGTTTTCA No data
Right 1002680007 5:180954452-180954474 CAGCCACAGACAGGAACACCGGG No data
1002680000_1002680005 19 Left 1002680000 5:180954401-180954423 CCCCACCACCAAGTTAGTTTTCA No data
Right 1002680005 5:180954443-180954465 AAACTAAAGCAGCCACAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002680000 Original CRISPR TGAAAACTAACTTGGTGGTG GGG (reversed) Intergenic
No off target data available for this crispr