ID: 1002680002

View in Genome Browser
Species Human (GRCh38)
Location 5:180954403-180954425
Sequence AATGAAAACTAACTTGGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002680002_1002680007 26 Left 1002680002 5:180954403-180954425 CCACCACCAAGTTAGTTTTCATT No data
Right 1002680007 5:180954452-180954474 CAGCCACAGACAGGAACACCGGG No data
1002680002_1002680005 17 Left 1002680002 5:180954403-180954425 CCACCACCAAGTTAGTTTTCATT No data
Right 1002680005 5:180954443-180954465 AAACTAAAGCAGCCACAGACAGG No data
1002680002_1002680006 25 Left 1002680002 5:180954403-180954425 CCACCACCAAGTTAGTTTTCATT No data
Right 1002680006 5:180954451-180954473 GCAGCCACAGACAGGAACACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002680002 Original CRISPR AATGAAAACTAACTTGGTGG TGG (reversed) Intergenic
No off target data available for this crispr