ID: 1002680007

View in Genome Browser
Species Human (GRCh38)
Location 5:180954452-180954474
Sequence CAGCCACAGACAGGAACACC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002680002_1002680007 26 Left 1002680002 5:180954403-180954425 CCACCACCAAGTTAGTTTTCATT No data
Right 1002680007 5:180954452-180954474 CAGCCACAGACAGGAACACCGGG No data
1002680000_1002680007 28 Left 1002680000 5:180954401-180954423 CCCCACCACCAAGTTAGTTTTCA No data
Right 1002680007 5:180954452-180954474 CAGCCACAGACAGGAACACCGGG No data
1002680001_1002680007 27 Left 1002680001 5:180954402-180954424 CCCACCACCAAGTTAGTTTTCAT No data
Right 1002680007 5:180954452-180954474 CAGCCACAGACAGGAACACCGGG No data
1002680003_1002680007 23 Left 1002680003 5:180954406-180954428 CCACCAAGTTAGTTTTCATTATA No data
Right 1002680007 5:180954452-180954474 CAGCCACAGACAGGAACACCGGG No data
1002680004_1002680007 20 Left 1002680004 5:180954409-180954431 CCAAGTTAGTTTTCATTATAAAG No data
Right 1002680007 5:180954452-180954474 CAGCCACAGACAGGAACACCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002680007 Original CRISPR CAGCCACAGACAGGAACACC GGG Intergenic
No off target data available for this crispr