ID: 1002680049

View in Genome Browser
Species Human (GRCh38)
Location 5:180954639-180954661
Sequence AGCTGAGTCTGGAGGCCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002680043_1002680049 13 Left 1002680043 5:180954603-180954625 CCTCAGGAGAGGAAGCAGAGAGG No data
Right 1002680049 5:180954639-180954661 AGCTGAGTCTGGAGGCCAGAGGG No data
1002680042_1002680049 22 Left 1002680042 5:180954594-180954616 CCTGAGGCACCTCAGGAGAGGAA No data
Right 1002680049 5:180954639-180954661 AGCTGAGTCTGGAGGCCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002680049 Original CRISPR AGCTGAGTCTGGAGGCCAGA GGG Intergenic
No off target data available for this crispr