ID: 1002685455

View in Genome Browser
Species Human (GRCh38)
Location 5:181005798-181005820
Sequence TACATCGCATGCTGGATATA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 46}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002685455_1002685464 23 Left 1002685455 5:181005798-181005820 CCCTATATCCAGCATGCGATGTA 0: 1
1: 0
2: 0
3: 2
4: 46
Right 1002685464 5:181005844-181005866 TATTCATATGTCCAGTGTCCTGG 0: 1
1: 0
2: 1
3: 6
4: 103
1002685455_1002685459 -9 Left 1002685455 5:181005798-181005820 CCCTATATCCAGCATGCGATGTA 0: 1
1: 0
2: 0
3: 2
4: 46
Right 1002685459 5:181005812-181005834 TGCGATGTATGACGAGGAAAAGG 0: 1
1: 0
2: 0
3: 2
4: 54
1002685455_1002685461 -7 Left 1002685455 5:181005798-181005820 CCCTATATCCAGCATGCGATGTA 0: 1
1: 0
2: 0
3: 2
4: 46
Right 1002685461 5:181005814-181005836 CGATGTATGACGAGGAAAAGGGG 0: 1
1: 0
2: 0
3: 2
4: 55
1002685455_1002685465 24 Left 1002685455 5:181005798-181005820 CCCTATATCCAGCATGCGATGTA 0: 1
1: 0
2: 0
3: 2
4: 46
Right 1002685465 5:181005845-181005867 ATTCATATGTCCAGTGTCCTGGG 0: 1
1: 0
2: 2
3: 7
4: 154
1002685455_1002685466 25 Left 1002685455 5:181005798-181005820 CCCTATATCCAGCATGCGATGTA 0: 1
1: 0
2: 0
3: 2
4: 46
Right 1002685466 5:181005846-181005868 TTCATATGTCCAGTGTCCTGGGG 0: 1
1: 0
2: 1
3: 9
4: 284
1002685455_1002685460 -8 Left 1002685455 5:181005798-181005820 CCCTATATCCAGCATGCGATGTA 0: 1
1: 0
2: 0
3: 2
4: 46
Right 1002685460 5:181005813-181005835 GCGATGTATGACGAGGAAAAGGG 0: 1
1: 0
2: 0
3: 1
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002685455 Original CRISPR TACATCGCATGCTGGATATA GGG (reversed) Exonic
901892614 1:12280452-12280474 TACATCACATGCTAGATTTAAGG - Intronic
922250794 1:223846636-223846658 TACACCGCAAACTGGATAAAGGG + Intergenic
923765694 1:236890508-236890530 TACAAAGCATGGTGAATATAAGG - Intronic
1064600022 10:16984272-16984294 TACATCCCATGTTAGATCTATGG - Exonic
1068099669 10:52536218-52536240 AACATCTGATGCTGAATATAAGG + Intergenic
1072852481 10:98910700-98910722 TACATCACATACTGCATTTAAGG + Intronic
1081288144 11:41297978-41298000 TACATCTCCTGATTGATATAAGG - Intronic
1095824817 12:46519966-46519988 TAAATTGCATTCTGGACATAGGG - Intergenic
1098919255 12:76288232-76288254 TAGATAGATTGCTGGATATATGG + Intergenic
1112378905 13:98869916-98869938 AACATCGCAGGCTGGATAACTGG + Intronic
1119550940 14:75513717-75513739 AATATCTCAGGCTGGATATACGG - Intergenic
1119710465 14:76818481-76818503 TACAGCACATGCTGGTTATGTGG + Intronic
1122593880 14:102875154-102875176 TAGATCGCTTGCTGGAGAAATGG - Intronic
1123987434 15:25658014-25658036 TTCCTCTCATTCTGGATATATGG - Intergenic
1140014981 16:71173908-71173930 TACAAAGCATGCTGGATTTGAGG - Intronic
925559790 2:5178788-5178810 TCTATGGCATGCTGGATAGAGGG + Intergenic
928569179 2:32585758-32585780 TACAATGCATGCTTGATTTAGGG - Intronic
935275635 2:101473816-101473838 AACATCCCATCCTGGATCTAGGG + Intronic
946296329 2:218786552-218786574 TACATTGAATGCTGGAAAAATGG + Intronic
1170288238 20:14736073-14736095 TTCATCAAATGATGGATATATGG - Intronic
1174418003 20:50380224-50380246 TGCCTCGCATGCAGGATAGAAGG + Intergenic
953134234 3:40169081-40169103 AACATTGCATGTTGGGTATATGG - Intronic
960315190 3:116167758-116167780 TACATAGTATGTTGTATATAAGG - Intronic
966093829 3:176173640-176173662 TACATGGTATGCTGGATAACAGG + Intergenic
966626583 3:182023432-182023454 AACATCTCATTCTGGAAATAAGG - Intergenic
974439800 4:61901450-61901472 TTCATTTCATGCTGGATCTAAGG - Intronic
978335412 4:107662621-107662643 TATATCTCATGCTAGATTTAAGG - Intronic
982787711 4:159555829-159555851 CACTTAGCATGCTGGAGATAAGG - Intergenic
986151807 5:5136976-5136998 TACATTGCACGCTTGATAAATGG - Intergenic
986603733 5:9500680-9500702 TATATCACATGCAGTATATAGGG + Intronic
987995727 5:25275992-25276014 TAGACCGCATGCTGCAAATAAGG - Intergenic
1000156556 5:158558089-158558111 GACATCACATGCTGGTTGTAAGG + Intergenic
1000614636 5:163413590-163413612 AACAAGGCATGCTGAATATATGG + Intergenic
1002685455 5:181005798-181005820 TACATCGCATGCTGGATATAGGG - Exonic
1002992749 6:2253087-2253109 TACATAGCCTGCTGTAGATAAGG - Intergenic
1012263555 6:97114463-97114485 TTCATGCCATGCTGGATATGTGG + Exonic
1021588143 7:22232188-22232210 TAAATGGCATGATGGATACAAGG - Intronic
1022977370 7:35571251-35571273 TACATTGCATGCTGAATCTACGG + Intergenic
1023605291 7:41925749-41925771 TACATTTCAAGCTGGATCTATGG + Intergenic
1028128196 7:87139332-87139354 TACCTCACATGGGGGATATAGGG + Intergenic
1040656016 8:49508759-49508781 TACATCACACGGTGGATAAAAGG - Intergenic
1042165603 8:65942804-65942826 TTCACCGCATGCTGGAGAAAAGG - Intergenic
1043845577 8:85159357-85159379 TTCATCACATGATGGATATTTGG - Intergenic
1047780281 8:128105447-128105469 TACACTGACTGCTGGATATAAGG + Intergenic
1054997130 9:71404914-71404936 TACAATGCATACTGGATATTTGG - Intronic
1056172117 9:83996375-83996397 TCCATGGCATGCTGGATTTCTGG + Intronic
1188326524 X:28809932-28809954 TTGATGGCATACTGGATATAGGG + Intronic
1192133198 X:68572317-68572339 TACATGGCATGAAGCATATATGG + Intergenic
1199388414 X:147250113-147250135 GACATGGCATGGTGGATACACGG - Intergenic