ID: 1002685467

View in Genome Browser
Species Human (GRCh38)
Location 5:181005855-181005877
Sequence CTGTCTCATCCCCAGGACAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 292}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002685467_1002685478 29 Left 1002685467 5:181005855-181005877 CCAGTGTCCTGGGGATGAGACAG 0: 1
1: 0
2: 4
3: 31
4: 292
Right 1002685478 5:181005907-181005929 ACAGACCCAGACACAGCCAAGGG 0: 1
1: 0
2: 0
3: 33
4: 400
1002685467_1002685469 -4 Left 1002685467 5:181005855-181005877 CCAGTGTCCTGGGGATGAGACAG 0: 1
1: 0
2: 4
3: 31
4: 292
Right 1002685469 5:181005874-181005896 ACAGAGAAGACCCTGCTTAAAGG 0: 1
1: 0
2: 0
3: 17
4: 163
1002685467_1002685470 -3 Left 1002685467 5:181005855-181005877 CCAGTGTCCTGGGGATGAGACAG 0: 1
1: 0
2: 4
3: 31
4: 292
Right 1002685470 5:181005875-181005897 CAGAGAAGACCCTGCTTAAAGGG 0: 1
1: 0
2: 2
3: 21
4: 177
1002685467_1002685477 28 Left 1002685467 5:181005855-181005877 CCAGTGTCCTGGGGATGAGACAG 0: 1
1: 0
2: 4
3: 31
4: 292
Right 1002685477 5:181005906-181005928 CACAGACCCAGACACAGCCAAGG 0: 1
1: 0
2: 3
3: 81
4: 775

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002685467 Original CRISPR CTGTCTCATCCCCAGGACAC TGG (reversed) Exonic
900187044 1:1337481-1337503 CTTTCTAGGCCCCAGGACACAGG - Intronic
900381418 1:2385890-2385912 CGGTCCCTTCTCCAGGACACGGG - Exonic
900515110 1:3078044-3078066 CTGTTTCCACCCCAGGACAGAGG - Intronic
900655242 1:3753681-3753703 CTGTCCCCTCTCCAGCACACTGG - Intronic
901035989 1:6336570-6336592 CTGTCTCCACCCCAGGAGACAGG - Intronic
902388467 1:16089156-16089178 CTGACTCAGCGCCTGGACACTGG + Intergenic
903265049 1:22153241-22153263 CTCTCTCATCCCCAGGAGAAAGG - Intergenic
905204913 1:36337900-36337922 CTGGCTCTTCCCAGGGACACTGG + Intergenic
906201886 1:43965878-43965900 CTGGCACATCCTCAGGTCACAGG - Intronic
911372124 1:97006234-97006256 CAATCTCATCCCCCTGACACTGG - Intergenic
912494431 1:110082435-110082457 CTGGCTGCTCCCCAAGACACTGG + Intergenic
915117025 1:153607685-153607707 CTGCTTCCTCCCCAGGACACAGG - Exonic
915594705 1:156889780-156889802 CTGCCTAGTACCCAGGACACAGG - Intergenic
915634815 1:157178609-157178631 CCCTCTCTTCCCCAGGAGACAGG - Intergenic
916644638 1:166770696-166770718 TTGTCTAATCCCCAGGACCCTGG - Intergenic
917929830 1:179815528-179815550 ATGGCTCATCGCCAGGAAACTGG - Exonic
920682478 1:208083551-208083573 CTGTCAGATTCCCAGGTCACAGG - Intronic
921893848 1:220379205-220379227 CTGTCTTATCGCAAGGACAGAGG + Intergenic
923109906 1:230882395-230882417 CTGCCTTATCGCCAGGACAGAGG + Intergenic
923147893 1:231210460-231210482 CCGCCTCTTCCCCAGGACTCAGG - Intronic
1064699482 10:18004310-18004332 CTTTTTCTTCTCCAGGACACAGG - Intronic
1067039568 10:42941955-42941977 CTGTCATCTCCCCAGGAGACAGG - Intergenic
1070380692 10:75878174-75878196 CTGGCTTATCCCAAGGACAGAGG + Intronic
1070808712 10:79286525-79286547 CTGTCTCTTCCCCAGTGCACGGG + Intronic
1071253881 10:83849365-83849387 CTCTCTCATGCTCAGGAGACTGG + Intergenic
1071839156 10:89451120-89451142 TTATCTCATCCCCAAGCCACAGG - Intronic
1072785054 10:98273610-98273632 CTGTCTCAGCAGCTGGACACAGG + Intergenic
1074343076 10:112653443-112653465 CTGTGCCTTCCCCAGCACACAGG - Intronic
1074995594 10:118754807-118754829 CTGTCTCAACCCCGGGCCAGCGG + Exonic
1076272882 10:129170026-129170048 CTGCATCATGCACAGGACACAGG + Intergenic
1076403146 10:130196171-130196193 CTCTCCCAACCCCTGGACACTGG - Intergenic
1076698473 10:132258127-132258149 GTGTCCCAGCCCCAGGACATCGG + Intronic
1076731235 10:132440238-132440260 CTGTCTCCCCCCCAGCACACGGG + Intergenic
1076731310 10:132440506-132440528 CTGTCTCCCCCCCAGCACACAGG + Intergenic
1076731322 10:132440540-132440562 CTGTCTCCCCCCCAGCACACGGG + Intergenic
1076731334 10:132440574-132440596 CTGTCTCCCCCCCAGCACACGGG + Intergenic
1077014563 11:393924-393946 CTGTCCCAGCCCCACGACAAAGG + Intronic
1077252349 11:1566232-1566254 CCATCTCATCCCTGGGACACAGG + Intronic
1077928586 11:6707248-6707270 CTGTCTCAGCCTCTGGATACAGG + Intergenic
1078113904 11:8426045-8426067 CTGCCTCATCACAAGGACAGAGG + Intronic
1078552006 11:12287690-12287712 CCTGCTCTTCCCCAGGACACTGG - Intronic
1079031445 11:16989112-16989134 AAGTTTCATCCCCAGAACACAGG - Intronic
1079392060 11:20031084-20031106 CTGTTTCAGGACCAGGACACAGG + Intronic
1080700979 11:34643803-34643825 CTTTGGCATCCCCAGGACCCTGG + Intronic
1081669262 11:44934054-44934076 CTGCCTCTACCCTAGGACACTGG - Exonic
1083677279 11:64333122-64333144 CTGTCTCCTCCCCAGGGAATCGG - Intergenic
1084867354 11:72070003-72070025 CTGTCTGATCCACAGAACGCTGG - Intronic
1085018662 11:73191472-73191494 CTTTCTCAGTCCCAGGACCCAGG + Intergenic
1087139988 11:94755875-94755897 CTGCCTTATCCCAAGGACAGAGG + Intronic
1087461929 11:98456628-98456650 CTGTCTCATTGCAAGGACAGAGG + Intergenic
1088392188 11:109326908-109326930 CTGTCTCCACCCCACAACACAGG + Intergenic
1089214258 11:116826307-116826329 CTGTCCCTTCCCCAGGCCAGAGG + Intergenic
1090306264 11:125693720-125693742 CTGTCTCAGCCCAGGGCCACAGG - Intergenic
1202807905 11_KI270721v1_random:14721-14743 CTGTCTTTTCCCCAGTACAAGGG + Intergenic
1092124714 12:6066943-6066965 CTGCCTGGTCCCCAGGACAGTGG + Intronic
1092448259 12:8578319-8578341 CTACCTCGTCCCCAGGACTCAGG + Intergenic
1093896348 12:24578802-24578824 AGGTCTCAGCCCCAAGACACAGG + Intergenic
1097283998 12:57863863-57863885 CCTTCACATCCCCAGGAAACTGG - Intergenic
1100275349 12:93066964-93066986 CTGTGGCATGACCAGGACACAGG + Intergenic
1101269296 12:103126178-103126200 CTGTATCTGCCCCAGGAAACTGG + Intergenic
1101442382 12:104713389-104713411 TAGTCCCATTCCCAGGACACTGG - Intronic
1103315211 12:120048757-120048779 CTGTTTCATCCCCAGTACCTAGG + Intronic
1104791660 12:131486308-131486330 CTGTCTCATTACTAGGACCCTGG + Intergenic
1106249360 13:27972045-27972067 CTGCCTCCTCCCAGGGACACAGG - Intergenic
1108321928 13:49298180-49298202 CTGGCCCATCCCCAGGGAACAGG - Intergenic
1108732580 13:53249882-53249904 CAGTTTCATCCCCAGGAATCAGG - Intergenic
1110524286 13:76517751-76517773 ATGTCTGATTTCCAGGACACTGG + Intergenic
1117329838 14:54701647-54701669 CAGCCTCACCCCCAGGACTCTGG + Intronic
1119152537 14:72375488-72375510 CTTTCTCAGGCCCAGGACATGGG - Intronic
1120745302 14:88146564-88146586 CTGCCTTATCCCAAGGACAGAGG - Intergenic
1121737057 14:96225927-96225949 CTGTGCCATCCCCAGGACACCGG + Intronic
1122138453 14:99647861-99647883 CTCTCTCCTCCAGAGGACACAGG - Intronic
1122268234 14:100556651-100556673 CTGTCTCCTCATCAGGGCACAGG + Intronic
1122284061 14:100640411-100640433 CTGTCTCATCCACCGGACCTGGG + Intergenic
1122717861 14:103706182-103706204 CAGCGTCATCCCCAGGACCCAGG - Intronic
1122938803 14:104972095-104972117 CTGTCCCAGCCCCAGGGCAGGGG + Intronic
1126831960 15:52616657-52616679 CAGTCTATTTCCCAGGACACTGG + Intronic
1128043673 15:64597779-64597801 CTGCCCCATCCCCAGCTCACAGG + Intronic
1129038243 15:72664015-72664037 CTGTCACCTGCCCAGGACCCTGG - Intronic
1129211645 15:74073216-74073238 CTGTCACCTGCCCAGGACCCTGG + Intronic
1129398758 15:75267868-75267890 CTGTCACCTGCCCAGGACCCTGG - Intronic
1129402366 15:75292144-75292166 CTGTCACCTGCCCAGGACCCTGG - Intronic
1129728768 15:77917491-77917513 CTGTCACCTGCCCAGGACCCTGG + Intergenic
1130036681 15:80367495-80367517 CTGTCTCATCAGCAGGAAAATGG + Intronic
1130214650 15:81956868-81956890 CTGTCTCATCCTCATGAGACAGG + Intergenic
1130235766 15:82132214-82132236 CTGCCTCAGCACCAGGACACAGG - Intronic
1130381570 15:83376549-83376571 CTGTCCCATTCCCAGCACATTGG + Intergenic
1131617976 15:94036453-94036475 CTGTCTCATCCCCTGCACACTGG + Intergenic
1132802221 16:1760032-1760054 CTGCCTCAGCCCCACCACACAGG - Intronic
1133017024 16:2948581-2948603 CTGTGGCATCCCCAGGAAAAAGG + Intronic
1133036934 16:3038733-3038755 CTGTCCCAGCCCCAGGACCCAGG - Intergenic
1133650672 16:7810566-7810588 GTGTCTCATCCTAAGAACACAGG + Intergenic
1134015558 16:10885677-10885699 CTATCTCTTCCCCAGGACCCTGG + Intronic
1136390886 16:29963438-29963460 CTGTCCCATTCCTGGGACACAGG - Exonic
1136602692 16:31305792-31305814 CTGTTTCATCCCAAGGACGCAGG - Intronic
1136871789 16:33813737-33813759 TTGTCCAATCCCCAGGGCACAGG + Intergenic
1138473721 16:57258403-57258425 GGGTCTCAGCCCCAGGACTCAGG - Intronic
1138497560 16:57417412-57417434 CTGGGCCATCCCCAGGACTCTGG - Intergenic
1142325926 16:89414612-89414634 CAGTCTCCTACCCAGGACAGTGG - Intronic
1203100383 16_KI270728v1_random:1302321-1302343 TTGTCCAATCCCCAGGGCACAGG - Intergenic
1142614045 17:1124867-1124889 CTGTCTCCTCCAGAGGACCCAGG - Intronic
1142788578 17:2244962-2244984 CCGCCTCATCCCCTGCACACAGG - Intronic
1143432868 17:6899775-6899797 CTGCCTCCTTCCCAGGACCCAGG - Intronic
1144320816 17:14117788-14117810 CTGCCTTATCCCAAGGACAAAGG + Intronic
1144621313 17:16820275-16820297 CTGCCTCATCCCCAGGCCCCAGG - Intergenic
1144812352 17:18008612-18008634 CTGTCTGGGCCCCAGGACAGAGG - Intronic
1145002686 17:19316390-19316412 CTATCTCCTCCCCAAGTCACTGG - Intronic
1145989582 17:29070848-29070870 CTGTTTCTTCCCCAGGGCCCTGG - Intergenic
1146763071 17:35495514-35495536 TTGTGGCATCTCCAGGACACAGG + Intronic
1147536642 17:41326325-41326347 CTGGCTCACCCCCAGCCCACAGG + Intergenic
1148358812 17:46995238-46995260 CTGTCTAAGCCCCAGGACCTAGG + Intronic
1150439463 17:65179519-65179541 CTCTCTCCTCCCCAGGAAAGAGG - Intronic
1152755158 17:82084146-82084168 CTGCTGCATCCCCAGGACGCTGG - Exonic
1152775602 17:82199813-82199835 CTCTCTCTTTCCCTGGACACTGG + Intronic
1153333211 18:3895756-3895778 CTGTTTCATCCGCAGCACACAGG + Intronic
1155083229 18:22430867-22430889 CTCTCTCATCCCCAGGTCATGGG + Intergenic
1156468672 18:37363847-37363869 CTGTCTTATGCTCAGGACCCTGG + Intronic
1156473202 18:37390298-37390320 TTCTCTCATCCCCAGGGCTCTGG - Intronic
1156534909 18:37853269-37853291 TTGCCTCCTCCCCAGGCCACTGG + Intergenic
1156887903 18:42156757-42156779 CTGTCTCATCCCCATGCCATAGG - Intergenic
1157661401 18:49448207-49448229 CTGTCTCATCAGCAGGAAAATGG + Intronic
1158856084 18:61544373-61544395 CTGCCTTATCACAAGGACACAGG + Intronic
1160811852 19:1016244-1016266 CCCTGTCTTCCCCAGGACACAGG - Intronic
1161170189 19:2808604-2808626 CTGGGGCAGCCCCAGGACACGGG - Intronic
1161172662 19:2820653-2820675 CTGTCTTATCACCAGGACAGCGG - Intronic
1161247117 19:3259270-3259292 CTGCCCCCGCCCCAGGACACTGG + Intronic
1164256853 19:23534670-23534692 CTTTCTTTTCCCGAGGACACTGG + Intronic
1166305405 19:41934671-41934693 CTGTCTCAGACCCAGGAGTCAGG - Intergenic
1166544436 19:43625749-43625771 CTCTCTCCTCCTCAGGACCCAGG + Intronic
1166689266 19:44813011-44813033 CTCTCTCCTTCCTAGGACACAGG - Intronic
1167278495 19:48552895-48552917 CTGACTCATCCCCAGGAAGAGGG - Intronic
1167671830 19:50858060-50858082 CTGTTTCATCCTGAAGACACAGG + Exonic
1168116356 19:54223092-54223114 TTGTCTCATCCTCAGCCCACAGG + Intronic
1168119342 19:54242867-54242889 TTGTCTCATCCTCAGCCCACAGG + Intronic
1168270791 19:55248695-55248717 CTGACTCAGCCCCAGGCCCCAGG + Intronic
927949183 2:27155908-27155930 CTGCCCCATCCCCAGGACTTGGG + Exonic
931691786 2:64839823-64839845 CGATATCATCCCCAGTACACAGG - Intergenic
932403912 2:71500848-71500870 CTGAGTCAGCCCCAGGACCCGGG - Intronic
932461628 2:71885545-71885567 CTTTCCCATGCCCAGGACACAGG + Intergenic
932615758 2:73230374-73230396 CTCTATCCTCCCCAGGACAGAGG - Intronic
932766230 2:74472245-74472267 TTGTTTCTTCCCCAGGAGACGGG - Exonic
934041188 2:88128958-88128980 CTGGCACATCCCAAGGCCACTGG - Intergenic
934165239 2:89288362-89288384 CTGTCTCACAGCCAGGACACAGG + Intergenic
934202035 2:89894100-89894122 CTGTCTCACAGCCAGGACACAGG - Intergenic
934552098 2:95268904-95268926 CTGTCTCCTCCCCAGGGGTCAGG + Intergenic
934605891 2:95694844-95694866 CTGCCTCTCCCCCAGGTCACTGG - Intergenic
934623977 2:95833234-95833256 CTCTGTCAGCCCCAGAACACTGG + Intergenic
934624101 2:95833751-95833773 CTCTGTCAGCCCCAGAACACTGG + Intergenic
934624129 2:95833854-95833876 CTCTGTCAGCCCCAGAACACTGG + Intergenic
934624154 2:95833957-95833979 CTCTGTCAGCCCCAGAACACTGG + Intergenic
934624201 2:95834173-95834195 CTCTGTCAGCCCCAGAACACTGG + Intergenic
934624232 2:95834276-95834298 CTCTGTCAGCCCCAGAACACTGG + Intergenic
934624374 2:95834899-95834921 CTCTGTCAGCCCCAGAACACTGG + Intergenic
934624460 2:95835246-95835268 CTCTGTCAGCCCCAGAACACTGG - Intergenic
934624538 2:95835556-95835578 CTCTGTCAGCCCCAGAACACTGG - Intergenic
934624568 2:95835659-95835681 CTCTGTCAGCCCCAGAACACTGG - Intergenic
934809016 2:97265761-97265783 CTCTGTCAGCCCCAGAACACTGG + Intergenic
934809046 2:97265864-97265886 CTCTGTCAGCCCCAGAACACTGG + Intergenic
934809122 2:97266173-97266195 CTCTGTCAGCCCCAGAACACTGG + Intergenic
934809198 2:97266482-97266504 CTCTGTCAGCCCCAGAACACTGG + Intergenic
934809314 2:97266920-97266942 CTCTGTCAGCCCCAGAACACCGG - Intergenic
934809343 2:97267023-97267045 CTCTGTCAGCCCCAGAACACTGG - Intergenic
934809486 2:97267632-97267654 CTCTGTCAGCCCCAGAACACTGG - Intergenic
934809580 2:97268052-97268074 CTCTGTCAGCCCCAGAACACTGG - Intergenic
934809607 2:97268155-97268177 CTCTGTCAGCCCCAGAACACTGG - Intergenic
934809629 2:97268258-97268280 CTCTGTCAGCCCCAGAACACTGG - Intergenic
934809657 2:97268361-97268383 CTCTGTCAGCCCCAGAACACTGG - Intergenic
934809680 2:97268463-97268485 CTCTGTCATCCCAAGAACACCGG - Intergenic
934809849 2:97269187-97269209 CTCTGTCAGCCCCAGAACACTGG - Intergenic
934809950 2:97269599-97269621 CTCTGTCAGCCCCAGAACACTGG - Intergenic
934810002 2:97269803-97269825 CTCTGTCAGCCCCAGGACACTGG - Intergenic
934827690 2:97438136-97438158 CTCTGTCAGCCCCAGGACACTGG + Intergenic
934827742 2:97438340-97438362 CTCTGTCAGCCCCAGAACACTGG + Intergenic
934827848 2:97438798-97438820 CTCTGTCAGCCCCAGAACACTGG + Intergenic
934828014 2:97439521-97439543 CTCTGTCATCCCAAGAACACCGG + Intergenic
934828107 2:97489929-97489951 CTCTGTCAGCCCCAGAACACTGG + Intergenic
934828136 2:97490032-97490054 CTCTGTCAGCCCCAGAACACTGG + Intergenic
934828216 2:97490341-97490363 CTCTGTCAGCCCCAGAACACTGG + Intergenic
934828307 2:97490687-97490709 CTCTGTCAGCCCCAGAACACTGG - Intergenic
934828383 2:97490996-97491018 CTCTGTCAGCCCCAGAACACTGG - Intergenic
934828459 2:97491305-97491327 CTCTGTCAGCCCCAGAACACTGG - Intergenic
934828489 2:97491408-97491430 CTCTGTCAGCCCCAGAACACTGG - Intergenic
935470682 2:103456162-103456184 GTGTCCCAGCTCCAGGACACCGG - Intergenic
935855351 2:107267406-107267428 CTGTTTCCTTCCCAGGGCACAGG + Intergenic
936461224 2:112714953-112714975 TTGCCCCATCCCCAGGCCACAGG + Intergenic
938683992 2:133719199-133719221 CTCTCTCCTCTCCAGGATACAGG - Intergenic
939451184 2:142376555-142376577 CTGCCTTATCGCAAGGACACAGG - Intergenic
942602556 2:177656671-177656693 CTGTCTCTTCCCCATTAGACGGG - Intronic
943415839 2:187602933-187602955 CTCTCTCATCCTCAGGAGGCTGG + Intergenic
946301727 2:218828145-218828167 GTGTCTCAGCACAAGGACACTGG - Intronic
946371631 2:219284972-219284994 CTGCCTCATCCTCTGAACACCGG + Exonic
946396852 2:219447718-219447740 CAGACTCAGCCCCAGGACTCGGG - Intronic
947582968 2:231333077-231333099 TTGGCACCTCCCCAGGACACTGG + Intronic
948427777 2:237898743-237898765 CTTTCACATCCCCAGGGCCCGGG + Intronic
948551005 2:238772969-238772991 CCCTCCCATCCCCAGGAGACAGG - Intergenic
948770131 2:240247634-240247656 CTGCCTGCTTCCCAGGACACTGG - Intergenic
1168841999 20:915620-915642 CTGTCGTATCCCCAGCACCCAGG + Intronic
1169292560 20:4365175-4365197 CTTCCTCAGCCCCAGGACTCTGG + Intergenic
1170434223 20:16308571-16308593 CTTTCTCCTCCCCAAGACATAGG + Intronic
1170769436 20:19319206-19319228 CTGTCCCATGAGCAGGACACTGG + Intronic
1171220050 20:23388034-23388056 CTGTCTTAGAGCCAGGACACTGG + Intronic
1172438455 20:34947486-34947508 CAGTCTTTTCCCCAGGAGACTGG - Intronic
1172696710 20:36828043-36828065 GTGTCTCAGTCCAAGGACACTGG + Intronic
1173482911 20:43417009-43417031 GTTTCTCAGGCCCAGGACACAGG - Intergenic
1173674215 20:44820082-44820104 CTTTCTCATTCCCAGGAGACTGG - Intergenic
1174780245 20:53382823-53382845 CTGTCTCAAACCCAAGCCACAGG - Intronic
1175203411 20:57292897-57292919 CTGTCCCCTCCCCTGCACACTGG - Intergenic
1175716061 20:61254348-61254370 TTGTCTCCTCTCCAGGTCACCGG - Intronic
1177070994 21:16507847-16507869 CTCCCTCATCCCCAGGATCCCGG - Intergenic
1179731297 21:43369185-43369207 CAGGCTCATCCCAAGGACAGTGG + Intergenic
1179809900 21:43864385-43864407 CCCTCTCAGCCCCAGGACAGCGG - Intergenic
1179881087 21:44293600-44293622 CAGTCCCATCCCCAGGAGGCAGG - Intronic
1180050992 21:45330931-45330953 CTGTCTCAGCCCCAGGGGAAAGG + Intergenic
1182073536 22:27479397-27479419 CTGTCTGCCCCCCAGGAGACAGG + Intergenic
1183149046 22:36022982-36023004 CTGTGGCAGCCCAAGGACACTGG + Intronic
1183162634 22:36125131-36125153 CTTTCTTGTCCCCAGGACAGTGG + Intergenic
1183310701 22:37108088-37108110 CCGTCGCACCCCAAGGACACTGG + Intronic
1183642478 22:39100949-39100971 TTGTCTCCTCCTCTGGACACAGG + Intronic
1184098461 22:42329256-42329278 CATCCTCATCCCCAGCACACAGG + Intronic
1184187038 22:42871837-42871859 CTGTCCCCTCCCCAGGGCCCCGG + Intronic
1185156658 22:49197089-49197111 CTGTGGCTTCCACAGGACACAGG + Intergenic
949887238 3:8705803-8705825 CTGTCTGAGCTCCAGGCCACAGG - Intronic
950202898 3:11057412-11057434 GTGTCTCTTCCACTGGACACAGG + Intergenic
950515653 3:13463326-13463348 CTCTCTAATCCCCAAGAAACAGG - Intergenic
950524160 3:13513810-13513832 AGTTCCCATCCCCAGGACACAGG - Intergenic
950769576 3:15300893-15300915 CTCACTCATCCCCAGGACCTGGG + Intronic
952551630 3:34485179-34485201 CTGTCTCAAGACAAGGACACTGG + Intergenic
953732778 3:45464469-45464491 CTGTCTCAGCCCCAGAACAGAGG + Intronic
955480593 3:59385557-59385579 CTGTCTTATCACAAGGACAGAGG - Intergenic
957029255 3:75221259-75221281 CTGTCTTATCGCAAGGACAGAGG + Intergenic
961330929 3:126137588-126137610 CTGTCTGATGCTCAGGACATGGG - Intronic
968288679 3:197522774-197522796 TTCTCTCCTCCCCAGGACAAAGG - Exonic
969688232 4:8688828-8688850 CCGGCTCATCCCCAGAACAATGG + Intergenic
969704810 4:8785932-8785954 CTTTGGCAGCCCCAGGACACTGG + Intergenic
970598879 4:17625108-17625130 CAGTTGCATCCCCAGGGCACAGG + Exonic
973718003 4:53696129-53696151 CTGTTTTATCAGCAGGACACTGG - Intronic
974394337 4:61315328-61315350 CTGCCCCATTTCCAGGACACAGG + Intronic
974616468 4:64289709-64289731 TTGTCTCATCCCAATCACACAGG - Exonic
977064514 4:92296698-92296720 CTGTCTTATCCCCAGGTCCCAGG - Intergenic
980438329 4:132809675-132809697 CTGCCTTATCCCAAGGACAGAGG - Intergenic
981351003 4:143729529-143729551 CTGTCTCCTTCCCAGAAGACTGG - Intergenic
981423828 4:144581222-144581244 CTGTCTTATCACAAGGACAGTGG - Intergenic
982929076 4:161378991-161379013 CCGTCTCACCCCCAGGGAACAGG - Intergenic
985663513 5:1169382-1169404 CTGAACCAACCCCAGGACACCGG - Intergenic
986057009 5:4147989-4148011 CCTTGTCATCCCCAGCACACAGG + Intergenic
986288223 5:6377032-6377054 CTGGCACATCCCCAGCACCCAGG + Intronic
989094979 5:37773449-37773471 ATGTCTCATCCCCAGATGACTGG - Intergenic
991643772 5:68780000-68780022 CTGTCTCGCCCCCAGCACAGTGG + Intergenic
993661667 5:90645191-90645213 CAGTCTCAGCACCGGGACACGGG + Intronic
996818599 5:127600280-127600302 CTGTCTCTTCCCCTTGAAACTGG - Intergenic
997625510 5:135328206-135328228 CTGCCTCACCCCAAGGGCACAGG - Intronic
997744309 5:136285672-136285694 CTGAGTCATCCTCAGGCCACTGG - Intronic
998711585 5:144831997-144832019 CTGTCCTCTCCCCAGGACATAGG + Intergenic
999696515 5:154191775-154191797 GTGTTCCATCCTCAGGACACTGG - Intronic
1000256290 5:159541618-159541640 TTCTCTCTTCCTCAGGACACTGG - Intergenic
1000528704 5:162390816-162390838 CTGTCTTTTTCCCAGGATACTGG + Intergenic
1001381664 5:171309965-171309987 CTGTCCCTTCCCCCGGGCACGGG - Intronic
1001400169 5:171441710-171441732 CTGTTGCATCCCCAGTACACAGG + Intronic
1002379759 5:178818184-178818206 CTGTTTCTTCCCCAGGACAGGGG + Intergenic
1002685467 5:181005855-181005877 CTGTCTCATCCCCAGGACACTGG - Exonic
1003599725 6:7505869-7505891 CTTTCACATCCCCAGGGCTCGGG + Intergenic
1004176641 6:13345877-13345899 TTGCCTCATCACCAGGACAATGG + Intergenic
1005019327 6:21402430-21402452 CACTCTCACCCCCAGGACTCTGG - Intergenic
1006153412 6:32001397-32001419 CAGTCTCACCCTCAGCACACTGG - Exonic
1006159720 6:32034134-32034156 CAGTCTCACCCTCAGCACACTGG - Exonic
1006960915 6:37928983-37929005 CAGTCTCATCCCCATTACATAGG - Intronic
1007482677 6:42160355-42160377 CAGGCTCAGCCCCAGGGCACAGG - Intronic
1010616275 6:78016021-78016043 TTGTGTCCTCTCCAGGACACTGG - Intergenic
1012131569 6:95499992-95500014 CCCTGTCACCCCCAGGACACAGG + Intergenic
1012501466 6:99892847-99892869 CTGTCTCATCTACAGGGGACAGG - Intergenic
1013572375 6:111441945-111441967 CGGTCACACCCCCGGGACACAGG - Intronic
1013648006 6:112164125-112164147 CTGACTCATCCCCAGCACCATGG - Intronic
1016859349 6:148701236-148701258 CTGTCTCCTGCCCAGGTCTCCGG - Intergenic
1017824844 6:158074011-158074033 CTGTCTCTTCCCCAGGAATGGGG - Intronic
1020125874 7:5532268-5532290 CAGTCCCATCCCCAGGAGGCAGG - Intronic
1020214256 7:6177625-6177647 CTCTCTCCTCCCATGGACACGGG + Intronic
1022878762 7:34564212-34564234 CTGGCTCACCACCATGACACAGG - Intergenic
1024517147 7:50268611-50268633 ATGTCACATCCCTTGGACACAGG - Intergenic
1024943808 7:54788912-54788934 CTGTCTCAGCTCCACGACAGTGG + Intergenic
1025683114 7:63695470-63695492 CTTTCTCATCCTCAGGTCTCAGG - Intergenic
1025813926 7:64892457-64892479 CTCTGTCTTCCCCAGGACAGGGG + Intronic
1026271994 7:68844798-68844820 CTGTCTAATCACCAGGACCCAGG + Intergenic
1026522502 7:71129804-71129826 CTTTCTCAACCCAAGGACAAAGG - Intergenic
1026956085 7:74377174-74377196 CTGTGCCAGCCCCAGGGCACAGG - Intronic
1029164385 7:98576766-98576788 CACTGTCACCCCCAGGACACAGG - Intergenic
1029513563 7:101011994-101012016 CTTTCGCATCAACAGGACACAGG + Intronic
1031049969 7:116935026-116935048 CTGTTGCATCTCCAGGAAACAGG - Intergenic
1031972326 7:128073824-128073846 CTGTCTCATCCCGAGGACCCAGG - Intronic
1033418482 7:141185244-141185266 CTGCCTTATCTCCAGGACAGAGG + Intronic
1035305874 7:157930982-157931004 CTGTCTCACCTCCAGTGCACAGG + Intronic
1035596163 8:859635-859657 CTGTCTCAGCACCAGGCCTCTGG + Intergenic
1035686897 8:1530199-1530221 CAGTCTCAACCACAGGAGACAGG + Intronic
1038328534 8:26590239-26590261 CTTTCTAATCGCCAGGCCACAGG - Intronic
1039896308 8:41719142-41719164 CTGCCTCCTTCCCAGGACAGGGG - Intronic
1040275927 8:46013650-46013672 GTGTCTCACCCACAGGGCACTGG - Intergenic
1042936248 8:74061320-74061342 CTCTCTGCTCCCCAGCACACTGG + Intergenic
1044553458 8:93537036-93537058 CTGTCTGATCCCCAGGCTGCAGG + Intergenic
1044783147 8:95764040-95764062 CAGTCAGAACCCCAGGACACAGG + Intergenic
1045480816 8:102590780-102590802 CTGTCTCATGCTCAGGCCAGAGG + Intergenic
1046727822 8:117693708-117693730 CTGTCTCAGCCACAGGAAAATGG - Intergenic
1047586547 8:126279828-126279850 CTGCCTTATCCCAAGGACAGAGG - Intergenic
1048082952 8:131148741-131148763 CTGCCTTATCTCCAGGACAGGGG + Intergenic
1048193051 8:132307964-132307986 CTGTCTCATCCTCTGGTCCCCGG + Intronic
1049305215 8:141899263-141899285 AAGGCTCACCCCCAGGACACAGG + Intergenic
1049354065 8:142179105-142179127 CTGTCTCCTCCTCAAGACCCAGG - Intergenic
1049611893 8:143559691-143559713 CTGTCCCAGCCCCAGGGCAGAGG - Intronic
1049678089 8:143902430-143902452 ATTTCTCATCCCCAGGACGGCGG - Intergenic
1050153511 9:2641436-2641458 CCATCACATCTCCAGGACACTGG - Exonic
1053665828 9:40316854-40316876 CTGTCCCACATCCAGGACACAGG - Intronic
1054376983 9:64456883-64456905 CTGTCCCACATCCAGGACACAGG - Intergenic
1054518783 9:66059429-66059451 CTGTCCCACATCCAGGACACAGG + Intergenic
1056754446 9:89373137-89373159 CTCTCGCATCCCCAGGACACAGG + Intronic
1056812659 9:89776486-89776508 CTGCAGCTTCCCCAGGACACAGG + Intergenic
1057091213 9:92259614-92259636 TGGTCTCATGCCTAGGACACAGG + Intronic
1057197315 9:93122223-93122245 CTGTCTCCTTTCCAGGACCCTGG - Exonic
1060847230 9:126847202-126847224 ATGGCTCATCCTGAGGACACTGG - Intergenic
1061225975 9:129281209-129281231 CTGTCACATCCCCACAACACAGG - Intergenic
1061536975 9:131256456-131256478 GTGTCTCAGCCCCAGGAGGCAGG + Intergenic
1061811154 9:133163455-133163477 CGGCCTAATCCCCAGGACCCCGG - Intronic
1062206853 9:135342233-135342255 CTCTCGGATCCCTAGGACACGGG - Intergenic
1062235379 9:135505472-135505494 CTGTCTCATCTCCAGGGTCCTGG - Intergenic
1062468709 9:136692717-136692739 CTGACACGGCCCCAGGACACAGG - Intergenic
1187364662 X:18656622-18656644 CTGTTCCATCCCAAGGACAGGGG + Intronic
1188059435 X:25582836-25582858 CTGACTTATCTCCAGCACACAGG - Intergenic
1189888723 X:45577064-45577086 CAGTCCCATCCTCAGGACCCTGG + Intergenic
1190999739 X:55647341-55647363 CTATCTCATCCTGAAGACACAGG - Intergenic
1192329151 X:70160124-70160146 GTGTCTCAGCCCCAGGGAACTGG - Intronic
1199350908 X:146798615-146798637 CGGTGTCATCCTCAGGGCACAGG + Intergenic