ID: 1002692587

View in Genome Browser
Species Human (GRCh38)
Location 5:181060448-181060470
Sequence CTGGCTCCCTACCCTTTTGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 153}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002692587_1002692598 24 Left 1002692587 5:181060448-181060470 CCGGCAAAAGGGTAGGGAGCCAG 0: 1
1: 0
2: 2
3: 12
4: 153
Right 1002692598 5:181060495-181060517 TGTGGGACAATTTGAACATCAGG 0: 1
1: 0
2: 1
3: 8
4: 144
1002692587_1002692594 6 Left 1002692587 5:181060448-181060470 CCGGCAAAAGGGTAGGGAGCCAG 0: 1
1: 0
2: 2
3: 12
4: 153
Right 1002692594 5:181060477-181060499 GGGGCCTCACTGACCAATTGTGG 0: 1
1: 0
2: 2
3: 17
4: 93
1002692587_1002692595 7 Left 1002692587 5:181060448-181060470 CCGGCAAAAGGGTAGGGAGCCAG 0: 1
1: 0
2: 2
3: 12
4: 153
Right 1002692595 5:181060478-181060500 GGGCCTCACTGACCAATTGTGGG 0: 1
1: 0
2: 0
3: 8
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002692587 Original CRISPR CTGGCTCCCTACCCTTTTGC CGG (reversed) Exonic
901027311 1:6285421-6285443 CAGGCTCTCCACCCTTTTGCAGG - Intronic
901208587 1:7511602-7511624 ATGGCTTCCTTCCCTTCTGCTGG - Intronic
902624351 1:17667908-17667930 CTGGCACCCTACCCCCTTGGAGG + Intronic
903077998 1:20786973-20786995 CTAGCCCCCTGCCCTTTTGGTGG - Intronic
904689563 1:32283620-32283642 CTGGTTCCCTCCCTTTATGCTGG - Intronic
904767157 1:32859007-32859029 CTTGCTCCCTATTCTTTTGAAGG + Intergenic
904905861 1:33896813-33896835 CTGACTCCCTCCCCTATTTCAGG - Intronic
906085637 1:43131276-43131298 CTTGGTCCCTACCCTTGTGGAGG - Intergenic
906484253 1:46222122-46222144 CTTGCTCCCTCTCCTTTTCCAGG - Intergenic
906702159 1:47867477-47867499 CTGGCTTCCTTCCATTTTTCTGG + Intronic
906796405 1:48699637-48699659 CTGGCTCTCTTACCTTTTGTTGG + Intronic
912210895 1:107555838-107555860 CTGTCTCCTTGCCCATTTGCTGG - Intergenic
912404069 1:109421803-109421825 ATGGCTACCTAACATTTTGCTGG - Intronic
915274707 1:154780146-154780168 CTGCATGCCTACCCCTTTGCAGG - Intronic
916646582 1:166792598-166792620 CTGGCTCCATCCCATTTTCCTGG - Intergenic
917083825 1:171285377-171285399 CTGGCTCCTTCCCATTTTCCTGG - Exonic
917089798 1:171341588-171341610 CTGGCTCCATCCCATTTTCCAGG - Exonic
919690778 1:200526886-200526908 CTGGCTAACTACCCATCTGCCGG + Intergenic
920193938 1:204213698-204213720 GTGGCTCCCTACCCTCCAGCGGG - Intronic
920702915 1:208231308-208231330 CTGGCTGTTTACCCTTTTCCCGG - Intronic
920967752 1:210715284-210715306 GTCCCTCCCTACCCTCTTGCAGG - Intronic
1067168283 10:43882887-43882909 CTCTCTCCCTCCCCTTCTGCAGG + Intergenic
1067691399 10:48504430-48504452 TTGGCTCCCTGTCCTTTGGCTGG - Intronic
1069839237 10:71328797-71328819 CTGGCTACCTTCCCTATGGCAGG - Intronic
1070321496 10:75358141-75358163 CTGGTTCCCTAAGCTTTTGCTGG + Intergenic
1076270648 10:129149516-129149538 GTGGCTCCTTACCCCTGTGCCGG + Intergenic
1076307640 10:129476226-129476248 CTGGGTCACTTCCCTTTAGCTGG + Intronic
1077288773 11:1779314-1779336 CAGGCTCCCCACCCTCTGGCTGG - Intergenic
1079370066 11:19844884-19844906 CTGCCTCCCTACCCCTAAGCTGG - Intronic
1079733855 11:23970893-23970915 CTTGCTTCCTCCCCTTTGGCTGG - Intergenic
1080295603 11:30723628-30723650 CTGGATCCCTCCCCATTTGAGGG + Intergenic
1082850694 11:57761821-57761843 CAGGCTCCCTTGCCTTTGGCTGG + Exonic
1084832534 11:71780885-71780907 CTGGCTATCTTTCCTTTTGCCGG + Intergenic
1089223520 11:116895863-116895885 CTGTCTTCCTACCCTTTTTCAGG - Intronic
1094088282 12:26618541-26618563 CTAGCTCCCTATCCTTATGATGG - Intronic
1095378542 12:41560621-41560643 CTGTCTCCCTCCCTTATTGCTGG + Intronic
1101410339 12:104462490-104462512 CTCCCACCCTACCCCTTTGCAGG + Intronic
1103270056 12:119666020-119666042 CTGGCTCCCATCCCTTTTCCTGG + Intergenic
1103270062 12:119666039-119666061 CTGGCTCCCATCCCTTTTCCTGG + Intergenic
1104381942 12:128314944-128314966 CTGTCTCCCTCCCATTTTACAGG - Intronic
1104629918 12:130391657-130391679 CAGCCTCCCTACCATTCTGCTGG - Intergenic
1107393875 13:39995727-39995749 GTGGCTCCCTGCCCATCTGCAGG + Intergenic
1108534223 13:51356830-51356852 CTGCCTGCCTACCTTTCTGCTGG - Intronic
1109258304 13:60111235-60111257 CTGGATGCCTAACCTTTTTCTGG - Intronic
1112099297 13:96169546-96169568 CTGGCTCCCCACACCTTTGAGGG - Intronic
1118133485 14:62994895-62994917 CTGGCTTCCTTCCCTTTCGATGG + Intronic
1118643195 14:67812439-67812461 CTGGCTGCCTGTCCTTTTCCAGG - Intronic
1119712942 14:76836178-76836200 CTCTCTCCCTCCCCTTGTGCTGG + Intronic
1121127500 14:91417598-91417620 CTGGCTCCCCGCCCCTTTGTTGG - Intronic
1122128116 14:99590163-99590185 GATGCTCCCCACCCTTTTGCTGG - Intronic
1128527123 15:68420185-68420207 CTGAATCACTACCCTTTTGTGGG + Intronic
1133254448 16:4508041-4508063 CTGGGTCCCTTCCCCTGTGCTGG - Exonic
1133787700 16:8986010-8986032 CTTGCTCCCTTCCCATTTGCAGG + Intergenic
1133942778 16:10324269-10324291 ATGGATCCCTACCCTGTTTCTGG - Intergenic
1134213492 16:12297501-12297523 CTGGCTTCCTTCCCTTCTCCTGG + Intronic
1137713619 16:50584372-50584394 CTGATTCCATACCCTTTTGGGGG - Intronic
1140042519 16:71417956-71417978 CTGTGTCCCTAGCCTTTTTCCGG - Intergenic
1140602770 16:76498454-76498476 CTGGATCCATACTCTTTTGTAGG + Intronic
1141467482 16:84215925-84215947 AGAGCTTCCTACCCTTTTGCAGG + Intergenic
1142904736 17:3034210-3034232 CTGGCTTCCCACCCCTTTGTGGG - Exonic
1144937043 17:18908196-18908218 CTGGCTCCGTGGCCTCTTGCAGG - Intronic
1147547445 17:41413466-41413488 CTGGCTAGCTGCCCTTTTCCAGG - Intergenic
1147898356 17:43767276-43767298 CCAGCTCCCTAGCCTTTTCCAGG + Exonic
1150270293 17:63859896-63859918 CTGGGTCTCTTCCCTTTTGGAGG + Intergenic
1151748020 17:76022048-76022070 CTGTCTCCCCACCCTGCTGCTGG - Intronic
1152588165 17:81198297-81198319 CTGTCTCCCTGCTCTTTTGCAGG - Exonic
1157155584 18:45262394-45262416 CTGGCTAACTCCCCTTTTGCTGG - Intronic
1157282002 18:46352239-46352261 CTGGCTGCCTTCCCATTTTCTGG - Intronic
1157784682 18:50470984-50471006 CTGCCTCCCTACCCTATGGAAGG + Intergenic
1159202352 18:65203707-65203729 CTATCACCCTACCATTTTGCTGG + Intergenic
1160239052 18:77109668-77109690 TTTGCTCCCTACATTTTTGCAGG - Intronic
1161097788 19:2403222-2403244 CTGGGCCCCTTCCCTTTTCCAGG + Intronic
1161960027 19:7518044-7518066 CTAGCTTCCTACCCCCTTGCTGG - Intronic
1162233209 19:9284076-9284098 CTGTCTCCCTGCTCTTTTGGGGG - Intergenic
1164618336 19:29679750-29679772 CTGGCTCCCTGGCCTCTGGCAGG - Intergenic
1164694656 19:30234298-30234320 CTGGCCCCCTACCTCCTTGCTGG + Intronic
1167423950 19:49420170-49420192 CTTGCTCACAACCCTTTTACCGG - Intergenic
1168459886 19:56545677-56545699 CTTGGTCCCCACCCTTTGGCTGG - Intronic
1168583066 19:57571323-57571345 CTGGATCCCTACACTTTCTCTGG - Intergenic
925909669 2:8565595-8565617 CTGGCTCCCTGCCCTGTTCTGGG + Intergenic
927039785 2:19216971-19216993 CAAGCTCCCTACCCTGCTGCTGG + Intergenic
927779574 2:25928627-25928649 CTGGCTACCTTCCCTTCTGGAGG + Exonic
927902306 2:26829317-26829339 CCGACTCCCTCCCCTTTGGCTGG + Intergenic
928098358 2:28419697-28419719 CTGGGACCATCCCCTTTTGCTGG + Intergenic
931251154 2:60531609-60531631 CTTGCTCCATACACTTTGGCAGG + Intronic
932022642 2:68103273-68103295 CTGGCTCCCAACCCTTTCTCAGG - Intronic
934103871 2:88678713-88678735 CTGGCTCCCTTACCTTATTCAGG - Intergenic
934735122 2:96686138-96686160 CTGGCTCCCAGCCCTGCTGCAGG - Intergenic
935071931 2:99702223-99702245 CTGGCTCACTAACATATTGCTGG - Intronic
938114044 2:128591389-128591411 CTGCCTTCCTCCCCTGTTGCTGG + Intergenic
938722458 2:134078762-134078784 CTGGAACCCAACCCTTATGCTGG - Intergenic
940114389 2:150192339-150192361 CTGGCTTCATCCCCTTTTCCAGG - Intergenic
941690595 2:168497609-168497631 CTGACTCCCTCTCCTTTTCCTGG - Intronic
946134463 2:217634301-217634323 TTGGCTCCTGACCCTTTGGCCGG + Intronic
946407581 2:219500005-219500027 CTGGCACCTCACCCTTTTGAGGG - Exonic
947432755 2:230045131-230045153 CGGGCTCCTTACCCATTTGAAGG - Intronic
947507469 2:230719843-230719865 CTGGTTCCCTCCCCTTTTGCTGG + Intronic
948156836 2:235790333-235790355 CTGTCCCTCTACCCTTTTACTGG - Intronic
948910040 2:240998395-240998417 CTGGGTCCCTACCCTGGTGGAGG - Intergenic
948953195 2:241268476-241268498 CTGGCTACTGACCGTTTTGCTGG - Exonic
1175277702 20:57783286-57783308 CTGGCTCCCTTGCCCCTTGCTGG - Intergenic
1178676479 21:34635546-34635568 CTGCCTCCTTACCCTTTGGGTGG - Intergenic
1182978205 22:34643142-34643164 CTGGCTCCCTCCACATCTGCTGG - Intergenic
1183742978 22:39678619-39678641 CTGGCTTCCTGCCCCCTTGCTGG - Intronic
1183947549 22:41335253-41335275 TTGGCTTCCTTCTCTTTTGCAGG + Intronic
949107098 3:212622-212644 CTGGCTCCCTACTGCTTTGCAGG + Intronic
950461002 3:13122206-13122228 GTGGCTCCGTTACCTTTTGCAGG - Intergenic
950864959 3:16181638-16181660 CTGCCTCCTTCCTCTTTTGCAGG - Intronic
950902368 3:16509802-16509824 CTGTGTCCCTACCCTCTGGCAGG + Intronic
955390952 3:58521886-58521908 CTGCCACCCCACCCTTTAGCTGG + Intronic
956783953 3:72626865-72626887 CTGGCTCTTTTTCCTTTTGCAGG - Intergenic
961387269 3:126529789-126529811 CTGTCTCCCTAACCTCCTGCTGG + Intronic
962391058 3:134973238-134973260 CTGGCTCCCTTGCCTTCTTCAGG + Intronic
965811628 3:172596912-172596934 CTGGCTGCCTCCGCTTTTGAGGG + Intergenic
966259738 3:177961778-177961800 CTGACTTTCTAGCCTTTTGCAGG + Intergenic
970445835 4:16122721-16122743 GTGGCTCCCTACCCTATTGCAGG + Intergenic
970895046 4:21092627-21092649 TTGGCTCTCTACCCTTATGAAGG - Intronic
971980908 4:33748500-33748522 CTGGCTCCTTCCCCTCTTACAGG + Intergenic
976438271 4:85043808-85043830 CTGGCTCCAGCCCCTTTTCCAGG - Intergenic
981490194 4:145331294-145331316 CTGGCTGCCTCCCCTCCTGCTGG - Intergenic
982091633 4:151884699-151884721 CAGGCACCCTACCCTTCTGGAGG - Intergenic
982167672 4:152629491-152629513 CTGGCTCCACACCTTTTTCCTGG + Intronic
987311277 5:16683524-16683546 ATGACTCCCTTCCCCTTTGCTGG + Intronic
987769698 5:22284865-22284887 CTGGCTTCTTTCCCTTTTCCTGG - Intronic
992676814 5:79112941-79112963 CTGCCTCCCTACCATTTTCCGGG - Intronic
995689056 5:114803120-114803142 GTGGCTCCCTTCCCTTCTGAGGG + Intergenic
1001018783 5:168165383-168165405 CTGGCTCCCTTCCCCGTTCCTGG + Intronic
1001189018 5:169609394-169609416 CTTGCTCCCCACCCTTCTGCGGG - Intergenic
1001744588 5:174082508-174082530 CTGGCTTCCCTCCCTGTTGCAGG + Intronic
1001850927 5:174964449-174964471 TTGGCTCCCTAACCTTTTAAGGG + Intergenic
1002453819 5:179334222-179334244 CTGGCTCCCCCACCTTCTGCAGG + Intronic
1002692587 5:181060448-181060470 CTGGCTCCCTACCCTTTTGCCGG - Exonic
1004273856 6:14218477-14218499 CAGTCTCCCTACTCTTCTGCAGG + Intergenic
1004924602 6:20404153-20404175 CTGTCTTCCTTCCCTTGTGCTGG + Intronic
1005234202 6:23740985-23741007 ATGGCTCCCTGCCCCTTTTCTGG + Intergenic
1005902065 6:30225353-30225375 CTGGCTCTCTAACCTCTTTCAGG - Intergenic
1006669379 6:35720211-35720233 CTGGCTCCCTGCTCTGCTGCTGG - Intronic
1006813654 6:36836981-36837003 CTGGGTCAATACCCTTTTGGGGG - Intronic
1007257093 6:40537041-40537063 CTAGCTCCATAACCTTTGGCAGG - Intronic
1007549396 6:42717439-42717461 CCCTCTCCCTGCCCTTTTGCCGG + Intronic
1007847427 6:44771420-44771442 CTGGCTCCCCACCCCTTCACAGG - Intergenic
1009552027 6:65109766-65109788 CTGCCTACCTACCCTTCTACAGG + Intronic
1011632157 6:89338253-89338275 ATGGCTCCCTCTCCTTTTGTTGG + Exonic
1013771261 6:113630834-113630856 CTGGCTCCCTCCCCCTGTGATGG - Intergenic
1015761994 6:136672731-136672753 CTGGCTCCCAGCCCTTTGGGAGG + Intronic
1018279480 6:162170160-162170182 CTGTCTCCATACCCTTCTGAGGG + Intronic
1019637171 7:2082149-2082171 CTGCCTCCCTTCCCTTTCTCTGG - Intronic
1022766671 7:33420329-33420351 CTGGCTCCCTTCCCTTTGCTAGG + Intronic
1023866174 7:44239405-44239427 CTGCCTCCCTGCCCTTGTGGTGG + Intronic
1024150900 7:46570288-46570310 CTGTCCCACTACACTTTTGCTGG + Intergenic
1025101479 7:56138938-56138960 CTGGCTTCCTTCCCATTTGAAGG + Intergenic
1026932194 7:74229482-74229504 CTGGCTCTCTTCCCCTTTGGTGG + Exonic
1027184229 7:75960757-75960779 CTGGGTCCCTACCTTAGTGCGGG + Intronic
1028295841 7:89130314-89130336 CTGGCTTCCTACTCCTTTCCTGG - Intronic
1029217554 7:98962280-98962302 CTGGGTCCCTGCCCTGTTGTAGG + Exonic
1034490113 7:151388636-151388658 CTGCCTCCCTCGCCTTTTACAGG - Intronic
1037735845 8:21565306-21565328 CTGGCTTCCCACCCTATTGTGGG - Intergenic
1048205787 8:132414271-132414293 CTGACTCTCTGCCCTTCTGCAGG - Intronic
1048861943 8:138730159-138730181 CTGTCTCCCTGCCCATGTGCAGG + Intronic
1050506768 9:6356927-6356949 CTGTCTCCCTATCCTTAAGCAGG - Intergenic
1058868175 9:109180422-109180444 CTGGCTCCCTGCAGTCTTGCTGG - Intronic
1060745439 9:126127884-126127906 CTGGCTCCCATCCCTCCTGCAGG - Intergenic
1187173652 X:16875011-16875033 CAGGCGCCCTACCTTTTAGCTGG - Intergenic
1190040158 X:47064862-47064884 AGTGCTCCCTACCCTTTTGGGGG + Intergenic
1192549476 X:72042543-72042565 CTAGCTCCCCACTCTTTTTCAGG + Intergenic
1193829985 X:86278705-86278727 CTGGCTTCATCCCCTTTTCCAGG - Intronic
1198735971 X:139785692-139785714 CTGAGTCCCTTCCCTTATGCGGG + Intronic
1201455127 Y:14160959-14160981 CTGTCTCCCAACACTTTTGAGGG + Intergenic