ID: 1002696100

View in Genome Browser
Species Human (GRCh38)
Location 5:181092240-181092262
Sequence GGAGAAGTTTGTTATGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002696100_1002696105 -8 Left 1002696100 5:181092240-181092262 CCTCCCTCATAACAAACTTCTCC No data
Right 1002696105 5:181092255-181092277 ACTTCTCCAGGGTTGTTGCATGG No data
1002696100_1002696112 20 Left 1002696100 5:181092240-181092262 CCTCCCTCATAACAAACTTCTCC No data
Right 1002696112 5:181092283-181092305 GAGATAGACGAGGGCATGGGAGG No data
1002696100_1002696107 -2 Left 1002696100 5:181092240-181092262 CCTCCCTCATAACAAACTTCTCC No data
Right 1002696107 5:181092261-181092283 CCAGGGTTGTTGCATGGAGAAGG No data
1002696100_1002696110 16 Left 1002696100 5:181092240-181092262 CCTCCCTCATAACAAACTTCTCC No data
Right 1002696110 5:181092279-181092301 GAAGGAGATAGACGAGGGCATGG No data
1002696100_1002696111 17 Left 1002696100 5:181092240-181092262 CCTCCCTCATAACAAACTTCTCC No data
Right 1002696111 5:181092280-181092302 AAGGAGATAGACGAGGGCATGGG No data
1002696100_1002696109 11 Left 1002696100 5:181092240-181092262 CCTCCCTCATAACAAACTTCTCC No data
Right 1002696109 5:181092274-181092296 ATGGAGAAGGAGATAGACGAGGG No data
1002696100_1002696108 10 Left 1002696100 5:181092240-181092262 CCTCCCTCATAACAAACTTCTCC No data
Right 1002696108 5:181092273-181092295 CATGGAGAAGGAGATAGACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002696100 Original CRISPR GGAGAAGTTTGTTATGAGGG AGG (reversed) Intergenic
No off target data available for this crispr