ID: 1002696101

View in Genome Browser
Species Human (GRCh38)
Location 5:181092243-181092265
Sequence CCTGGAGAAGTTTGTTATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002696101_1002696107 -5 Left 1002696101 5:181092243-181092265 CCCTCATAACAAACTTCTCCAGG No data
Right 1002696107 5:181092261-181092283 CCAGGGTTGTTGCATGGAGAAGG No data
1002696101_1002696111 14 Left 1002696101 5:181092243-181092265 CCCTCATAACAAACTTCTCCAGG No data
Right 1002696111 5:181092280-181092302 AAGGAGATAGACGAGGGCATGGG No data
1002696101_1002696112 17 Left 1002696101 5:181092243-181092265 CCCTCATAACAAACTTCTCCAGG No data
Right 1002696112 5:181092283-181092305 GAGATAGACGAGGGCATGGGAGG No data
1002696101_1002696108 7 Left 1002696101 5:181092243-181092265 CCCTCATAACAAACTTCTCCAGG No data
Right 1002696108 5:181092273-181092295 CATGGAGAAGGAGATAGACGAGG No data
1002696101_1002696109 8 Left 1002696101 5:181092243-181092265 CCCTCATAACAAACTTCTCCAGG No data
Right 1002696109 5:181092274-181092296 ATGGAGAAGGAGATAGACGAGGG No data
1002696101_1002696110 13 Left 1002696101 5:181092243-181092265 CCCTCATAACAAACTTCTCCAGG No data
Right 1002696110 5:181092279-181092301 GAAGGAGATAGACGAGGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002696101 Original CRISPR CCTGGAGAAGTTTGTTATGA GGG (reversed) Intergenic
No off target data available for this crispr