ID: 1002696112

View in Genome Browser
Species Human (GRCh38)
Location 5:181092283-181092305
Sequence GAGATAGACGAGGGCATGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002696103_1002696112 16 Left 1002696103 5:181092244-181092266 CCTCATAACAAACTTCTCCAGGG No data
Right 1002696112 5:181092283-181092305 GAGATAGACGAGGGCATGGGAGG No data
1002696101_1002696112 17 Left 1002696101 5:181092243-181092265 CCCTCATAACAAACTTCTCCAGG No data
Right 1002696112 5:181092283-181092305 GAGATAGACGAGGGCATGGGAGG No data
1002696106_1002696112 -1 Left 1002696106 5:181092261-181092283 CCAGGGTTGTTGCATGGAGAAGG No data
Right 1002696112 5:181092283-181092305 GAGATAGACGAGGGCATGGGAGG No data
1002696099_1002696112 21 Left 1002696099 5:181092239-181092261 CCCTCCCTCATAACAAACTTCTC No data
Right 1002696112 5:181092283-181092305 GAGATAGACGAGGGCATGGGAGG No data
1002696100_1002696112 20 Left 1002696100 5:181092240-181092262 CCTCCCTCATAACAAACTTCTCC No data
Right 1002696112 5:181092283-181092305 GAGATAGACGAGGGCATGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002696112 Original CRISPR GAGATAGACGAGGGCATGGG AGG Intergenic
No off target data available for this crispr