ID: 1002696806

View in Genome Browser
Species Human (GRCh38)
Location 5:181097771-181097793
Sequence AATGTGGGTGACTTTCTGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002696806_1002696814 -3 Left 1002696806 5:181097771-181097793 CCACTCAGAAAGTCACCCACATT No data
Right 1002696814 5:181097791-181097813 ATTGGCCCTCTTTGGGGAGGCGG No data
1002696806_1002696819 10 Left 1002696806 5:181097771-181097793 CCACTCAGAAAGTCACCCACATT No data
Right 1002696819 5:181097804-181097826 GGGGAGGCGGCGTGAGAGGAGGG No data
1002696806_1002696817 6 Left 1002696806 5:181097771-181097793 CCACTCAGAAAGTCACCCACATT No data
Right 1002696817 5:181097800-181097822 CTTTGGGGAGGCGGCGTGAGAGG No data
1002696806_1002696810 -9 Left 1002696806 5:181097771-181097793 CCACTCAGAAAGTCACCCACATT No data
Right 1002696810 5:181097785-181097807 ACCCACATTGGCCCTCTTTGGGG No data
1002696806_1002696809 -10 Left 1002696806 5:181097771-181097793 CCACTCAGAAAGTCACCCACATT No data
Right 1002696809 5:181097784-181097806 CACCCACATTGGCCCTCTTTGGG No data
1002696806_1002696818 9 Left 1002696806 5:181097771-181097793 CCACTCAGAAAGTCACCCACATT No data
Right 1002696818 5:181097803-181097825 TGGGGAGGCGGCGTGAGAGGAGG No data
1002696806_1002696820 11 Left 1002696806 5:181097771-181097793 CCACTCAGAAAGTCACCCACATT No data
Right 1002696820 5:181097805-181097827 GGGAGGCGGCGTGAGAGGAGGGG No data
1002696806_1002696813 -6 Left 1002696806 5:181097771-181097793 CCACTCAGAAAGTCACCCACATT No data
Right 1002696813 5:181097788-181097810 CACATTGGCCCTCTTTGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002696806 Original CRISPR AATGTGGGTGACTTTCTGAG TGG (reversed) Intergenic
No off target data available for this crispr