ID: 1002696809

View in Genome Browser
Species Human (GRCh38)
Location 5:181097784-181097806
Sequence CACCCACATTGGCCCTCTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002696806_1002696809 -10 Left 1002696806 5:181097771-181097793 CCACTCAGAAAGTCACCCACATT No data
Right 1002696809 5:181097784-181097806 CACCCACATTGGCCCTCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002696809 Original CRISPR CACCCACATTGGCCCTCTTT GGG Intergenic
No off target data available for this crispr