ID: 1002697287

View in Genome Browser
Species Human (GRCh38)
Location 5:181099392-181099414
Sequence GGCACTCATCTGCATGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002697271_1002697287 26 Left 1002697271 5:181099343-181099365 CCATTCTGCCATAACCACTGCAG 0: 1
1: 0
2: 2
3: 21
4: 253
Right 1002697287 5:181099392-181099414 GGCACTCATCTGCATGGGGTGGG No data
1002697277_1002697287 -4 Left 1002697277 5:181099373-181099395 CCGAGGAGTAGCCCCCCAGGGCA 0: 1
1: 0
2: 1
3: 15
4: 181
Right 1002697287 5:181099392-181099414 GGCACTCATCTGCATGGGGTGGG No data
1002697274_1002697287 12 Left 1002697274 5:181099357-181099379 CCACTGCAGCTGCTCACCGAGGA 0: 1
1: 0
2: 2
3: 28
4: 258
Right 1002697287 5:181099392-181099414 GGCACTCATCTGCATGGGGTGGG No data
1002697272_1002697287 18 Left 1002697272 5:181099351-181099373 CCATAACCACTGCAGCTGCTCAC 0: 1
1: 0
2: 1
3: 12
4: 205
Right 1002697287 5:181099392-181099414 GGCACTCATCTGCATGGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002697287 Original CRISPR GGCACTCATCTGCATGGGGT GGG Intergenic
No off target data available for this crispr