ID: 1002697407

View in Genome Browser
Species Human (GRCh38)
Location 5:181100201-181100223
Sequence TCCAGATGGCCTGCAAGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 1, 2: 4, 3: 42, 4: 228}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002697407_1002697420 26 Left 1002697407 5:181100201-181100223 CCAGGGCTTGCAGGCCATCTGGA 0: 1
1: 1
2: 4
3: 42
4: 228
Right 1002697420 5:181100250-181100272 CACCCCCCTGGCTAGACTGCAGG 0: 1
1: 0
2: 0
3: 4
4: 140
1002697407_1002697414 3 Left 1002697407 5:181100201-181100223 CCAGGGCTTGCAGGCCATCTGGA 0: 1
1: 1
2: 4
3: 42
4: 228
Right 1002697414 5:181100227-181100249 CTGGGGTCCAGGGCTGTCCCCGG 0: 1
1: 0
2: 6
3: 54
4: 511
1002697407_1002697416 14 Left 1002697407 5:181100201-181100223 CCAGGGCTTGCAGGCCATCTGGA 0: 1
1: 1
2: 4
3: 42
4: 228
Right 1002697416 5:181100238-181100260 GGCTGTCCCCGGCACCCCCCTGG 0: 1
1: 0
2: 1
3: 28
4: 377
1002697407_1002697412 -8 Left 1002697407 5:181100201-181100223 CCAGGGCTTGCAGGCCATCTGGA 0: 1
1: 1
2: 4
3: 42
4: 228
Right 1002697412 5:181100216-181100238 CATCTGGAAAACTGGGGTCCAGG 0: 1
1: 0
2: 3
3: 25
4: 245
1002697407_1002697413 -7 Left 1002697407 5:181100201-181100223 CCAGGGCTTGCAGGCCATCTGGA 0: 1
1: 1
2: 4
3: 42
4: 228
Right 1002697413 5:181100217-181100239 ATCTGGAAAACTGGGGTCCAGGG 0: 1
1: 0
2: 1
3: 26
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002697407 Original CRISPR TCCAGATGGCCTGCAAGCCC TGG (reversed) Intergenic
901481630 1:9529212-9529234 TCTAGAGGGCCAGCAAGCCTCGG - Intergenic
904270909 1:29349484-29349506 TCCATGTGGCCCCCAAGCCCAGG - Intergenic
905150258 1:35921543-35921565 TCCAGCTGGCCTCCAAGCCTGGG - Exonic
905675868 1:39824683-39824705 TCCAGGTGGCCTGCATTCCTCGG - Intergenic
907078361 1:51598346-51598368 TCCAGTTGGCATTCAAGGCCTGG - Intronic
907395461 1:54186644-54186666 TCCAAATGGCCTGCTTCCCCAGG - Intronic
907444437 1:54498971-54498993 TCCAGCTGCCCTGCAGGACCTGG + Intergenic
911001446 1:93170364-93170386 GCCGGCCGGCCTGCAAGCCCTGG + Intronic
913371671 1:118106470-118106492 TGCAGTTGGCCTGGAAGCACTGG + Intronic
914203460 1:145506182-145506204 TCCGGCTGGTCTGCAAGCGCCGG + Intergenic
914482582 1:148079336-148079358 TCCGGCTGGTCTGCAAGCGCCGG + Intergenic
914677529 1:149916307-149916329 TCCTCAGGGCCAGCAAGCCCAGG + Intronic
916606053 1:166343296-166343318 GCCGGCTGGCCTGCAAGCCCCGG - Intergenic
917046272 1:170864092-170864114 TCCAGATGGACTACAACCTCTGG - Intergenic
918127413 1:181596615-181596637 CTCAGATGCCCTGCAGGCCCAGG + Intronic
922472011 1:225882549-225882571 TCCCGGAGGTCTGCAAGCCCCGG + Intergenic
923157264 1:231289805-231289827 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
1063165591 10:3459092-3459114 TCCAGCTGGCCTGCATGCTGAGG + Intergenic
1063466133 10:6246065-6246087 TCCCCATGGCCTGGATGCCCTGG + Intergenic
1064085665 10:12344722-12344744 TCCAGCTAGCCTGGAAGTCCAGG - Intergenic
1066188882 10:33037264-33037286 TCCAGATGGAGTCCAAGACCAGG + Intergenic
1067145607 10:43691631-43691653 TCCAGATGGATGGCAAGCCCAGG - Intergenic
1068373990 10:56155153-56155175 TCCAGCTGGCCAGCAAGCGCCGG - Intergenic
1068937833 10:62653259-62653281 TCCAGATGGCCTTATGGCCCAGG - Intronic
1070062960 10:73003783-73003805 TCCAGATGGCCAGCAACACAAGG - Intergenic
1070552005 10:77497259-77497281 TGCAAATGGCCTTCATGCCCAGG - Intronic
1071055688 10:81505923-81505945 GCCAGCCGGCCCGCAAGCCCTGG + Intergenic
1073458547 10:103652334-103652356 CCCAGATGGCCTGCAAAGTCTGG - Intronic
1074314421 10:112348466-112348488 TCCAGAAGGCCTGCAATACAAGG + Intergenic
1074879764 10:117646881-117646903 TCCACCTGGCCTGGGAGCCCGGG + Intergenic
1075409077 10:122214148-122214170 TCCAGGTGGCCAGCAGTCCCAGG + Intronic
1076091994 10:127694368-127694390 TCCAGATGGCCTGGCAGTCAGGG + Intergenic
1076167189 10:128292160-128292182 TTCAGAGGGACTGCAAGACCCGG + Intergenic
1076405963 10:130212701-130212723 TCCAGACGGCCTCCAATGCCCGG + Intergenic
1077364970 11:2157993-2158015 GCCAGCTGCCCTGCAAGTCCTGG + Intronic
1077525334 11:3060792-3060814 GTCACATGGCCTGCAAGCCAGGG + Intergenic
1078556064 11:12327160-12327182 TCTGGATGGCCTGCAACACCAGG - Exonic
1079004942 11:16784888-16784910 TCCTGATTGCCTGCCAGCCCAGG - Intronic
1079088140 11:17461765-17461787 TCCCGAGGACCTGCAAGACCTGG - Exonic
1081692797 11:45089487-45089509 CCCAGCTGGCCTCCAAGGCCAGG + Intergenic
1083008275 11:59368938-59368960 TCCAGCTGTCCTGTAAGCCTAGG + Intergenic
1084085625 11:66853823-66853845 GCAAGATGGCTTGGAAGCCCAGG - Intronic
1085245571 11:75098237-75098259 TCCAGCTGGCCTGCAAGCGCAGG - Intergenic
1085529168 11:77181541-77181563 TTCAGGTGGCCTGCCAGGCCAGG + Exonic
1086148634 11:83583344-83583366 TACCGAAAGCCTGCAAGCCCGGG + Intronic
1086397778 11:86433851-86433873 TCCAGCTGGCCCACAAGCGCCGG + Intergenic
1086531260 11:87788221-87788243 TTTACATGGCCTGCAAGGCCTGG - Intergenic
1088151440 11:106750108-106750130 TGCAGAAGGCCTGACAGCCCTGG + Intronic
1088462342 11:110093917-110093939 TCCAGATCGCCAGCAACCCCAGG + Intronic
1088708001 11:112481020-112481042 TCCGCATGACCTGCAAGACCAGG - Intergenic
1089077367 11:115748979-115749001 TCCAGAAGCCCTTCAAGACCTGG - Intergenic
1089201906 11:116729717-116729739 TCCAGGAGGGCTGCATGCCCTGG + Intergenic
1089372811 11:117973224-117973246 TACAGCTGGCTTGTAAGCCCAGG - Intergenic
1090315188 11:125780117-125780139 TCCAGGTGGGCAGCAAGTCCAGG - Intergenic
1091085926 11:132721797-132721819 TCCAGATGTCTTGAAAGCCGAGG - Intronic
1092908383 12:13123181-13123203 TCCTGATGGAATGCTAGCCCTGG + Intronic
1093381535 12:18500177-18500199 TCCAGCCGGCCGGCAAGCACTGG - Intronic
1095444989 12:42274032-42274054 TCCAGCTGGCCCGCAAGCACTGG + Intronic
1095587382 12:43863930-43863952 TCTAGCTGGCCCGCAAGCGCCGG - Intronic
1096801324 12:54112537-54112559 CCCAGATGGCGGGCAAGCCTGGG + Intergenic
1098515964 12:71376888-71376910 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
1098584389 12:72138756-72138778 GCCAGATGACCTACAAGCACTGG - Intronic
1099085498 12:78241676-78241698 CACTGATGGCCTGCAAGCCTTGG - Intergenic
1099380896 12:81951047-81951069 TCCACATGACCAGCAAGCACCGG - Intergenic
1101559337 12:105841098-105841120 TCCACATGGCTTCTAAGCCCCGG + Intergenic
1103721660 12:122978636-122978658 TGCAGATGGGCTGCCTGCCCGGG + Intronic
1104262221 12:127194639-127194661 GCCAGAATGCCTGAAAGCCCTGG - Intergenic
1104537308 12:129630124-129630146 CCCAGCTGGCCTGGAACCCCTGG + Intronic
1105798787 13:23884517-23884539 TGCAGCTGGGCTGCCAGCCCAGG - Intronic
1106351842 13:28937975-28937997 TCCAGAGGTCCTGCATGCCTCGG + Intronic
1107456530 13:40560592-40560614 TCCAAATGGCCTGCAAGCCCTGG - Exonic
1108857960 13:54819504-54819526 GCCAGAAGGACTGCAATCCCTGG + Intergenic
1113677386 13:112216014-112216036 TCCGAAGGGCCTGCAGGCCCTGG - Intergenic
1113750370 13:112772826-112772848 TGCAAATGGCCAACAAGCCCAGG - Intronic
1116452327 14:45080467-45080489 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
1120830311 14:88992219-88992241 TCCAGATGGCAAGCCTGCCCTGG + Intergenic
1121417624 14:93789687-93789709 TCCAGAAGGCCCTCAAGGCCTGG + Intergenic
1122144693 14:99682778-99682800 TCCAAATTGCCCTCAAGCCCCGG + Intergenic
1123821800 15:24037695-24037717 TACAGATGCCATACAAGCCCAGG + Intergenic
1124464660 15:29925991-29926013 TCCTGGTGGCCAGCAAGCCTTGG + Intronic
1124657008 15:31516854-31516876 TCATGATGGCCTCCATGCCCAGG + Intronic
1129360430 15:75020798-75020820 TCAGGATGGCCTGTAAGCCTAGG - Exonic
1129709748 15:77814727-77814749 TCCATCTGGCATCCAAGCCCAGG + Intronic
1129744379 15:78007926-78007948 TCCCGCTGGCCTGCAGGGCCAGG + Intronic
1129824504 15:78625738-78625760 TCCAGGTGTTCTGTAAGCCCCGG - Intronic
1130537542 15:84798058-84798080 TCCACAGGGCCTGCTGGCCCTGG - Intronic
1131563690 15:93466193-93466215 CCCAGGTGGCCTGTAAGCCCAGG + Intergenic
1132751789 16:1461018-1461040 CCCAGACCGCCTGCAGGCCCCGG + Intronic
1133918187 16:10127989-10128011 TCCAGAGGACCTGGAAGCCAAGG + Intronic
1134177165 16:12016689-12016711 TGCAGATGGCCAACAAGCACAGG - Intronic
1135856916 16:26020121-26020143 TCCAGAAGCTCTGCATGCCCTGG - Intronic
1136670694 16:31854590-31854612 TCCAGAAGGCCTGCCATCACTGG + Intergenic
1137445111 16:48526886-48526908 TGCTGCTGGGCTGCAAGCCCTGG - Intergenic
1137491091 16:48933374-48933396 TCCAGATGCCCTTCAGGACCAGG - Intergenic
1138770733 16:59660654-59660676 TTGAGATGGCCTGCATTCCCTGG + Intergenic
1139910873 16:70396801-70396823 ACCAGATGGCCTGCAGAGCCTGG + Intronic
1140299065 16:73738812-73738834 TCCAGCTGACATGGAAGCCCGGG - Intergenic
1140736397 16:77901634-77901656 TGCTGATGGCCTGCAAACCTGGG - Intronic
1141478017 16:84286811-84286833 TCATGATGGCACGCAAGCCCTGG + Intergenic
1144848880 17:18234109-18234131 TCCAGATGACCAGCAGGCCCCGG - Exonic
1145250700 17:21295513-21295535 CCCAGATGGCCAGGCAGCCCAGG - Intronic
1147324161 17:39662494-39662516 TCCAGATGGTCTCTTAGCCCTGG + Intronic
1148463167 17:47849806-47849828 TCCCTAAGGCCTGGAAGCCCTGG + Intronic
1151283342 17:73092542-73092564 TCCTGATGGCCTCCGACCCCGGG + Intronic
1151745042 17:76007421-76007443 TCCAGAAGGGCTGGATGCCCCGG - Exonic
1152308576 17:79535574-79535596 TGCAGCAGACCTGCAAGCCCAGG - Intergenic
1154119974 18:11644323-11644345 TCCAGAGTCCTTGCAAGCCCGGG - Intergenic
1155611743 18:27674192-27674214 TCCAGCTGGCTGGCAAGCGCCGG + Intergenic
1157516968 18:48318070-48318092 TCTAGAGGGCCTGGAAGCCTTGG - Intronic
1160144041 18:76349515-76349537 TCCTGCTGGCCTGCACGCCAAGG + Intergenic
1161314813 19:3612852-3612874 GCCAGTGGGCCAGCAAGCCCAGG + Intronic
1165461122 19:35944967-35944989 TCCAGCTGGACTGCGAGCCCTGG + Exonic
1165820233 19:38670233-38670255 CACAGATGGCCTGAAATCCCAGG - Intronic
1168689673 19:58368999-58369021 CCCCGAGGGGCTGCAAGCCCGGG - Exonic
926108054 2:10164798-10164820 CCCAGATGGACTGCAGGACCAGG - Intronic
927084073 2:19657005-19657027 TGCAGATGGCCTGGGGGCCCAGG - Intergenic
927121549 2:19968926-19968948 GCCAGATGGCCAGGTAGCCCAGG - Intronic
927215961 2:20667873-20667895 ACCAGCCGGCCTGCAAGGCCAGG - Intronic
927509577 2:23636000-23636022 TTCAGAATGTCTGCAAGCCCAGG - Intronic
929070023 2:38020543-38020565 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
931771156 2:65499293-65499315 TCCCCTTGGCCTTCAAGCCCAGG - Intergenic
933506315 2:83181140-83181162 GCCAGCCGGCCTGCAAGCCCCGG + Intergenic
934040500 2:88124237-88124259 TCCACCTGCCCTGCATGCCCAGG - Intronic
935243550 2:101198679-101198701 TCAGGATGGCCTCCAATCCCTGG + Intronic
936069121 2:109353588-109353610 CCCAGCAGGCCTGCCAGCCCTGG - Intronic
936580651 2:113697655-113697677 TACAAATGGCCAGCAAGTCCAGG + Intergenic
938465056 2:131519858-131519880 TCCAGATGGGCTGCAGCTCCGGG - Intergenic
938936698 2:136133540-136133562 TCCAGATGGCTTCCAAGCGAGGG + Intergenic
941769722 2:169331666-169331688 TTAAGATGGCCTGCCTGCCCAGG + Intronic
942317630 2:174709897-174709919 TCCAGCTGGCCCGCAAGCGCGGG + Intergenic
943106185 2:183546975-183546997 TCGTGCTGGCCTGCAAGCCCAGG + Intergenic
944590872 2:201216893-201216915 GCTATATGTCCTGCAAGCCCAGG + Intronic
944630427 2:201618842-201618864 TCCAGGTGCCCTGCTGGCCCCGG + Intronic
945401382 2:209387476-209387498 GCCAGCCGGCCGGCAAGCCCCGG + Intergenic
947411959 2:229850749-229850771 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
948604768 2:239127856-239127878 CCCAGCTGCCCTGCGAGCCCTGG - Intronic
948626032 2:239268611-239268633 ACTAGATGGCCTGCAGGCCAAGG + Intronic
948689581 2:239693583-239693605 TGCAGATGGCCAACAAGCCCGGG - Intergenic
948832709 2:240606035-240606057 ACCAGATGGCCTGCAAGCTATGG - Intronic
1168849181 20:965117-965139 TCCAGGAGGCCTGCAGACCCTGG - Intronic
1170400352 20:15976566-15976588 GGCAGATGGGCTGGAAGCCCTGG + Intronic
1170733137 20:18991080-18991102 TCCCTATGGCATACAAGCCCTGG + Intergenic
1170843509 20:19943076-19943098 TCCCGATGCCCTTCAAGCCCGGG - Intronic
1171334452 20:24370877-24370899 TGAACATGGCCTGCAAGCCTGGG - Intergenic
1171355181 20:24538874-24538896 TACAGATGGCCAATAAGCCCAGG - Intronic
1171795362 20:29561929-29561951 CCCAGATGGCAGGCAAGCCTGGG - Intergenic
1171853090 20:30322336-30322358 CCCAGATGGCAGGCAAGCCTGGG + Intergenic
1172752104 20:37258292-37258314 TCCAGAAGCCCAGCCAGCCCCGG + Intronic
1173668213 20:44778081-44778103 TTCAGATGGACTTCAAGACCTGG - Intronic
1173696899 20:45024877-45024899 TCCAGATGGGCTACAATCTCTGG - Intronic
1174842352 20:53912147-53912169 GCCAACTGGCCTGCAGGCCCAGG - Intergenic
1175771046 20:61624536-61624558 ACCAAATGGCCTCCAAGGCCAGG + Intronic
1175904422 20:62372492-62372514 GCCAGAAGGCCTCGAAGCCCAGG + Intergenic
1176294287 21:5062738-5062760 TCCCGATGAACTGGAAGCCCTGG - Intergenic
1176390586 21:6161112-6161134 TCCAGATGGCCCCCAGGCCGTGG - Intergenic
1176423281 21:6532958-6532980 CCCAAATGCCCTGCAAGCCAAGG - Intergenic
1178137273 21:29641720-29641742 TCTAGGTTGCTTGCAAGCCCAGG - Intronic
1179698774 21:43141274-43141296 CCCAAATGCCCTGCAAGCCAAGG - Intergenic
1179732881 21:43377127-43377149 TCCAGATGGCCCCCAGGCCGTGG + Intergenic
1179862973 21:44200910-44200932 TCCCGATGAACTGGAAGCCCTGG + Intergenic
1181038068 22:20179376-20179398 TCCAGGTGGGCCTCAAGCCCAGG - Intergenic
1181156694 22:20926747-20926769 TAGTGATGGCCTGAAAGCCCAGG + Intronic
1183474557 22:38028889-38028911 TCCAAAGGCCCTGCAAGCCCCGG + Intronic
1183508499 22:38222080-38222102 GCCAGAGGGCCTGGAAGCCAGGG + Intronic
1184644206 22:45887670-45887692 TCCAGGTGGCCTGCAGACCTCGG + Intergenic
949261624 3:2108101-2108123 TACAGTTGGTCTGCAAGCCTGGG - Intronic
949769961 3:7568629-7568651 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
949842011 3:8330024-8330046 TCCAGATGACGTGCAGCCCCTGG + Intergenic
950068959 3:10136655-10136677 CTCAGCCGGCCTGCAAGCCCAGG - Intergenic
950464304 3:13144259-13144281 TGCAGCTGGACTGCACGCCCGGG + Intergenic
953002857 3:38951183-38951205 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
953982933 3:47421760-47421782 CTCAGCTGGCCTGCCAGCCCTGG + Intronic
954321944 3:49838287-49838309 TCCTGCTGGCCTGAAAGCCAAGG + Intronic
954321957 3:49838334-49838356 CCAAGATGGGCTGCAGGCCCTGG + Intronic
954864851 3:53719507-53719529 GCCAGATTCCCTGCAGGCCCTGG - Intronic
956632590 3:71331229-71331251 GCCAGCTGGCCCGCAAGCCTGGG + Intronic
956806524 3:72819219-72819241 TCCAGATTGCCTACAAACCAAGG - Intronic
959192174 3:103128491-103128513 TCTACATGTCTTGCAAGCCCAGG + Intergenic
959896977 3:111616833-111616855 TGCAGCTGCCCTGAAAGCCCAGG - Intronic
960282104 3:115791593-115791615 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
961385780 3:126522582-126522604 TGCAGATGACCTGGAATCCCTGG + Intergenic
962758219 3:138484680-138484702 TCCAGCTGGCCCGCAAGCACCGG - Intergenic
963727110 3:148934987-148935009 TTCAGATTGCCTCCAATCCCTGG + Intergenic
964037510 3:152217334-152217356 TCCAGTTGGCCTGCAAGTGCAGG - Intergenic
964375043 3:156041416-156041438 GCCAGCCGGCCTGCAAGCCCCGG + Intronic
966076051 3:175937471-175937493 GCCAGCTGCCCTGCCAGCCCCGG + Intergenic
968731857 4:2272930-2272952 CCCAGATGGGCTGCCCGCCCAGG - Intronic
970108306 4:12609729-12609751 GCCGGCAGGCCTGCAAGCCCCGG + Intergenic
972783581 4:42306935-42306957 TCCAAATGACCCACAAGCCCTGG + Intergenic
973193620 4:47414893-47414915 TCCAGTTGGTCTGAAGGCCCAGG - Intronic
975298791 4:72765930-72765952 TCCTGCTGGCCTGCAAGCACCGG - Intergenic
976127404 4:81848721-81848743 CCCAGATGGCCTGGAACCCAGGG - Intronic
977657269 4:99536547-99536569 TCCAGATGGCCTGCACTCCCTGG + Intronic
980259996 4:130436250-130436272 TACAGATGGCCTCAAAGCCCTGG + Intergenic
980827347 4:138088898-138088920 TCGTGCTGGCCTGCAAGCGCCGG + Intergenic
981146806 4:141333522-141333544 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
982622688 4:157727307-157727329 TCCACAAGGCCTGCAATCCTGGG + Intergenic
984532343 4:180932357-180932379 TCCAGATGAGCTTCAAGCTCTGG - Intergenic
985904561 5:2823294-2823316 GTCAGAGGCCCTGCAAGCCCAGG - Intergenic
986912420 5:12574273-12574295 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
991054427 5:62306272-62306294 TCCTGCCGGCCTGCAGGCCCGGG + Intronic
993219150 5:85068171-85068193 TCCAGTTGGCCTGCAAGATATGG - Intergenic
993822003 5:92631365-92631387 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
995112385 5:108442301-108442323 GCCAGCCGGCCCGCAAGCCCCGG - Intergenic
997471674 5:134120723-134120745 TCCAGCTGCCTTGCCAGCCCTGG + Intronic
998080925 5:139274278-139274300 TTCAGATGCCCTCCAAGCTCGGG - Intronic
1000328229 5:160188165-160188187 TCCAGAGGGGCGGGAAGCCCTGG + Intronic
1001682804 5:173571006-173571028 TACAAAAGGCCTGCACGCCCTGG - Intergenic
1001994321 5:176143327-176143349 TCCTGTTGGGCTGCATGCCCAGG - Intergenic
1002697407 5:181100201-181100223 TCCAGATGGCCTGCAAGCCCTGG - Intergenic
1002790740 6:435800-435822 GCCAGTTGGCCCGCAAGTCCCGG - Intergenic
1002890986 6:1331609-1331631 CCTACAAGGCCTGCAAGCCCAGG - Intergenic
1002971459 6:2026193-2026215 GCCACATGGCCAGAAAGCCCAGG - Intronic
1003080782 6:3019586-3019608 TCCAGATGGTCTGCAGCCTCTGG - Exonic
1003465584 6:6376916-6376938 GCCAGAAAGCCTGAAAGCCCCGG + Intergenic
1004800883 6:19145984-19146006 TTCAGATGTCCTCCAAGCCCTGG + Intergenic
1005320354 6:24646721-24646743 TCCAGTTAACCTGCAAGGCCTGG - Intergenic
1006940425 6:37748411-37748433 TCCTGCCAGCCTGCAAGCCCTGG - Intergenic
1007422940 6:41730434-41730456 ACCAGGTGGCCTGCATGGCCTGG + Intronic
1008211968 6:48736582-48736604 TCCAGAGTGCCTCCATGCCCAGG - Intergenic
1008270519 6:49483745-49483767 TACAGCTGACCTGCAAGCACCGG + Intronic
1009901434 6:69812124-69812146 TCCAGATGGCTTGCAAGCAAGGG + Intergenic
1014236923 6:118968351-118968373 TGCATATGGCCTGCAGGCCGTGG + Intronic
1014448564 6:121557661-121557683 CTCAGATGTCTTGCAAGCCCTGG + Intergenic
1017377316 6:153786340-153786362 CCCTGATGGTCAGCAAGCCCAGG - Intergenic
1019004162 6:168782450-168782472 TCCCCATGGCCAGCATGCCCAGG - Intergenic
1019589777 7:1825216-1825238 TCCACCTGGCCTGCAACCCTCGG + Intronic
1019868297 7:3734020-3734042 TCCAGATCTGCTGTAAGCCCTGG + Intronic
1020032651 7:4943689-4943711 TCCAGAAGGGCTACAAGCTCAGG - Intronic
1021448812 7:20762017-20762039 TCTAGATGGCCTGCATTCCTTGG + Intronic
1023396236 7:39754267-39754289 TCTAGCTGGCCTGCAAGCCCCGG + Intergenic
1023402140 7:39798098-39798120 TCCACCTGCCCTGAAAGCCCAGG - Intergenic
1026034311 7:66820093-66820115 TACCGCTGGGCTGCAAGCCCAGG + Intergenic
1026887855 7:73964914-73964936 TCCGGAGGGCCTGCCAGCACAGG + Intergenic
1026985287 7:74551427-74551449 TACTGCTGGGCTGCAAGCCCGGG - Intronic
1030324360 7:108204066-108204088 TCCAGATGGGAAGCAAGCACTGG + Intronic
1031728912 7:125273048-125273070 TACAAATGGCCAGCAAGCACAGG - Intergenic
1034632168 7:152539188-152539210 TCCAGCTGGCCCGCAAGCGCTGG + Intergenic
1037765415 8:21769471-21769493 TCCAGCTGCCCTGCAAGCACTGG - Intronic
1037814836 8:22106696-22106718 TCCAGTTGGCCTGCTGGCCCGGG - Intergenic
1038175458 8:25178288-25178310 GCCATATGGCCTGCAAAGCCTGG + Intergenic
1038250568 8:25900077-25900099 TCCAGGTTGCATGCAAGCCCAGG - Intronic
1043705726 8:83347571-83347593 GCTAGCTGGCCTCCAAGCCCTGG + Intergenic
1044610472 8:94087227-94087249 TGCAGAAACCCTGCAAGCCCAGG - Intergenic
1046288872 8:112132724-112132746 TCCAGCTGGCCTGCAAGCGCCGG - Intergenic
1048945803 8:139446016-139446038 GCCAGAGGGCATGGAAGCCCAGG - Intergenic
1049102358 8:140588777-140588799 TGCAGAGGGCCCGCCAGCCCTGG - Intronic
1049659613 8:143813926-143813948 TGCAGACGGCCTGCAGGCCATGG - Intronic
1051419721 9:16877316-16877338 GCCAGCAGGCCAGCAAGCCCCGG - Intergenic
1051586525 9:18732579-18732601 TCCCGATGGCCAGAAAGGCCTGG + Intronic
1052760115 9:32581675-32581697 TTCAGATAGTCTGCAAGACCTGG + Intergenic
1053351693 9:37417503-37417525 TGCAGACGACCTGCAAACCCTGG - Intergenic
1053790888 9:41685635-41685657 CCCAGATGGCAGGCAAGCCTGGG + Intergenic
1054154266 9:61629137-61629159 CCCAGATGGCAGGCAAGCCTGGG - Intergenic
1054179235 9:61897329-61897351 CCCAGATGGCAGGCAAGCCTGGG + Intergenic
1054351542 9:64021111-64021133 TCGAGATCGCCAGCATGCCCAGG - Intergenic
1054474051 9:65560257-65560279 CCCAGATGGCAGGCAAGCCTGGG - Intergenic
1054658303 9:67683492-67683514 CCCAGATGGCAGGCAAGCCTGGG - Intergenic
1054796914 9:69310943-69310965 TCCTGGTGGCCTTCAAGTCCTGG - Intergenic
1056146375 9:83734213-83734235 TCTAAATGGCCTGCAATCCTAGG - Intergenic
1056852482 9:90096224-90096246 TGCAGATGCCCTCCAAGCCCTGG + Intergenic
1057197183 9:93121648-93121670 TCTTGATGGCCACCAAGCCCAGG + Exonic
1057828098 9:98386594-98386616 TCCAGCTGCCCAGCAAGCCAGGG + Intronic
1059960784 9:119562568-119562590 TCAAGAAGCCCTGCTAGCCCTGG + Intergenic
1060701047 9:125748372-125748394 TCCCGACAGCCAGCAAGCCCCGG - Intronic
1061080196 9:128365262-128365284 TCCAGCAGGCCGGCCAGCCCGGG - Intergenic
1061289925 9:129644911-129644933 TCCAGATGGGGTGCTTGCCCTGG + Intergenic
1061398944 9:130358004-130358026 CCCAGCTGGCTTGCCAGCCCTGG - Intronic
1061844541 9:133379663-133379685 TCCCCATGCCCTGCTAGCCCTGG - Intronic
1187961950 X:24574872-24574894 ACCAGATGGCTTCCAAGCTCTGG + Intronic
1192251386 X:69416865-69416887 GCCGGCTGGCCCGCAAGCCCCGG + Intergenic
1194025600 X:88746590-88746612 GCCGGCTGGCCTGCAAGCCCCGG - Intergenic
1198239190 X:134766453-134766475 CCCTGATGGCCTGCCAGTCCTGG - Intergenic
1200071530 X:153531661-153531683 TCCAGATGGTCTGAATGCCCAGG + Intronic
1200258647 X:154599769-154599791 GACAGATGGCCTGGAGGCCCAGG - Intergenic
1201468312 Y:14309318-14309340 TCATGCTGGCCTGCAAGCACCGG - Intergenic