ID: 1002697813

View in Genome Browser
Species Human (GRCh38)
Location 5:181101589-181101611
Sequence CACCCACATTGGCCCTCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002697813_1002697816 -10 Left 1002697813 5:181101589-181101611 CCCAAAGAGGGCCAATGTGGGTG No data
Right 1002697816 5:181101602-181101624 AATGTGGGTGACTTTCTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002697813 Original CRISPR CACCCACATTGGCCCTCTTT GGG (reversed) Intergenic
No off target data available for this crispr