ID: 1002698680

View in Genome Browser
Species Human (GRCh38)
Location 5:181107423-181107445
Sequence TGCAAAAAAGCCAGTGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002698680_1002698686 20 Left 1002698680 5:181107423-181107445 CCCACCCCACTGGCTTTTTTGCA No data
Right 1002698686 5:181107466-181107488 CATTAATGAGTAACAGATAAGGG No data
1002698680_1002698685 19 Left 1002698680 5:181107423-181107445 CCCACCCCACTGGCTTTTTTGCA No data
Right 1002698685 5:181107465-181107487 TCATTAATGAGTAACAGATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002698680 Original CRISPR TGCAAAAAAGCCAGTGGGGT GGG (reversed) Intergenic
No off target data available for this crispr