ID: 1002700235

View in Genome Browser
Species Human (GRCh38)
Location 5:181118943-181118965
Sequence CACTTTAGGCAAAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002700223_1002700235 30 Left 1002700223 5:181118890-181118912 CCAGATGGCAAAGGGAGGCTCTG No data
Right 1002700235 5:181118943-181118965 CACTTTAGGCAAAAGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002700235 Original CRISPR CACTTTAGGCAAAAGGTGGA AGG Intergenic
No off target data available for this crispr