ID: 1002700673

View in Genome Browser
Species Human (GRCh38)
Location 5:181122360-181122382
Sequence GACACTCTAGGTGTTCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002700673_1002700682 30 Left 1002700673 5:181122360-181122382 CCTCTCTGAACACCTAGAGTGTC No data
Right 1002700682 5:181122413-181122435 AAGCCTGGGCCCAGCTTTGGAGG No data
1002700673_1002700681 27 Left 1002700673 5:181122360-181122382 CCTCTCTGAACACCTAGAGTGTC No data
Right 1002700681 5:181122410-181122432 CGGAAGCCTGGGCCCAGCTTTGG No data
1002700673_1002700679 16 Left 1002700673 5:181122360-181122382 CCTCTCTGAACACCTAGAGTGTC No data
Right 1002700679 5:181122399-181122421 CAGCTGCTCCTCGGAAGCCTGGG No data
1002700673_1002700676 7 Left 1002700673 5:181122360-181122382 CCTCTCTGAACACCTAGAGTGTC No data
Right 1002700676 5:181122390-181122412 ACCACACAGCAGCTGCTCCTCGG No data
1002700673_1002700678 15 Left 1002700673 5:181122360-181122382 CCTCTCTGAACACCTAGAGTGTC No data
Right 1002700678 5:181122398-181122420 GCAGCTGCTCCTCGGAAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002700673 Original CRISPR GACACTCTAGGTGTTCAGAG AGG (reversed) Intergenic