ID: 1002700678

View in Genome Browser
Species Human (GRCh38)
Location 5:181122398-181122420
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002700672_1002700678 16 Left 1002700672 5:181122359-181122381 CCCTCTCTGAACACCTAGAGTGT No data
Right 1002700678 5:181122398-181122420 GCAGCTGCTCCTCGGAAGCCTGG No data
1002700675_1002700678 3 Left 1002700675 5:181122372-181122394 CCTAGAGTGTCAGGAGCAACCAC No data
Right 1002700678 5:181122398-181122420 GCAGCTGCTCCTCGGAAGCCTGG No data
1002700673_1002700678 15 Left 1002700673 5:181122360-181122382 CCTCTCTGAACACCTAGAGTGTC No data
Right 1002700678 5:181122398-181122420 GCAGCTGCTCCTCGGAAGCCTGG No data
1002700670_1002700678 29 Left 1002700670 5:181122346-181122368 CCGGGACCTGAGGCCCTCTCTGA No data
Right 1002700678 5:181122398-181122420 GCAGCTGCTCCTCGGAAGCCTGG No data
1002700671_1002700678 23 Left 1002700671 5:181122352-181122374 CCTGAGGCCCTCTCTGAACACCT No data
Right 1002700678 5:181122398-181122420 GCAGCTGCTCCTCGGAAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002700678 Original CRISPR GCAGCTGCTCCTCGGAAGCC TGG Intergenic
No off target data available for this crispr