ID: 1002700682

View in Genome Browser
Species Human (GRCh38)
Location 5:181122413-181122435
Sequence AAGCCTGGGCCCAGCTTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002700675_1002700682 18 Left 1002700675 5:181122372-181122394 CCTAGAGTGTCAGGAGCAACCAC No data
Right 1002700682 5:181122413-181122435 AAGCCTGGGCCCAGCTTTGGAGG No data
1002700677_1002700682 -1 Left 1002700677 5:181122391-181122413 CCACACAGCAGCTGCTCCTCGGA No data
Right 1002700682 5:181122413-181122435 AAGCCTGGGCCCAGCTTTGGAGG No data
1002700673_1002700682 30 Left 1002700673 5:181122360-181122382 CCTCTCTGAACACCTAGAGTGTC No data
Right 1002700682 5:181122413-181122435 AAGCCTGGGCCCAGCTTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002700682 Original CRISPR AAGCCTGGGCCCAGCTTTGG AGG Intergenic
No off target data available for this crispr