ID: 1002700931

View in Genome Browser
Species Human (GRCh38)
Location 5:181124418-181124440
Sequence CTCATTTACAGCTTGAGGAA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 217}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002700931_1002700938 -8 Left 1002700931 5:181124418-181124440 CCATTCCTCAAGCTGTAAATGAG 0: 1
1: 0
2: 3
3: 17
4: 217
Right 1002700938 5:181124433-181124455 TAAATGAGGGGGTTCAGCATGGG 0: 2
1: 12
2: 72
3: 123
4: 208
1002700931_1002700940 18 Left 1002700931 5:181124418-181124440 CCATTCCTCAAGCTGTAAATGAG 0: 1
1: 0
2: 3
3: 17
4: 217
Right 1002700940 5:181124459-181124481 AAGGACTGTGTAGAAGATAGAGG 0: 1
1: 1
2: 1
3: 21
4: 253
1002700931_1002700939 -1 Left 1002700931 5:181124418-181124440 CCATTCCTCAAGCTGTAAATGAG 0: 1
1: 0
2: 3
3: 17
4: 217
Right 1002700939 5:181124440-181124462 GGGGGTTCAGCATGGGAGTAAGG 0: 1
1: 2
2: 5
3: 17
4: 253
1002700931_1002700937 -9 Left 1002700931 5:181124418-181124440 CCATTCCTCAAGCTGTAAATGAG 0: 1
1: 0
2: 3
3: 17
4: 217
Right 1002700937 5:181124432-181124454 GTAAATGAGGGGGTTCAGCATGG 0: 1
1: 9
2: 54
3: 84
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002700931 Original CRISPR CTCATTTACAGCTTGAGGAA TGG (reversed) Exonic
901337083 1:8459389-8459411 GTCATTTAAAACTGGAGGAAGGG + Intronic
901925359 1:12562510-12562532 CTCTTGTACAGCCTGTGGAATGG + Intergenic
904627378 1:31814671-31814693 CTCATTCAGAGTGTGAGGAAGGG - Exonic
905370281 1:37479361-37479383 CCCATTTTCAGATAGAGGAACGG + Intronic
906720173 1:47998227-47998249 CTCATTTGCCTCTTGAGGAAGGG - Intergenic
907113745 1:51950512-51950534 CTCATTTAGAACTTCAGGATTGG + Intronic
908527922 1:65005434-65005456 CAAATTTACAGCTGGATGAAAGG + Intergenic
908712317 1:67030318-67030340 ATAATTTAGAGCTGGAGGAAAGG - Intronic
911404128 1:97415049-97415071 TTCTTTTATAGCTTTAGGAAGGG - Intronic
912361133 1:109096759-109096781 ATCTTTTACAGGTGGAGGAATGG + Exonic
912521125 1:110245356-110245378 CTGAGTTAGAACTTGAGGAATGG - Intronic
913069470 1:115285996-115286018 ATAATTTACAGGTTGAGGTAGGG + Exonic
913189823 1:116404142-116404164 CTCAGTTACAGTTTGAGGACTGG + Intronic
914764253 1:150624163-150624185 CTCATGAACAGGTGGAGGAAAGG - Intronic
914840944 1:151248174-151248196 CCCATTTCCAGCATGAAGAATGG - Intronic
917013971 1:170508360-170508382 CTGGTTTACTGCTTGTGGAAAGG + Intergenic
917711633 1:177690960-177690982 CCCATTTACAACTTTAAGAATGG + Intergenic
922273610 1:224056658-224056680 CTCATATACAGATGGTGGAAGGG - Intergenic
924274935 1:242376207-242376229 CTCAGTTCCATTTTGAGGAATGG - Intronic
924484088 1:244462867-244462889 CTGATTTAAAGCTTTAGGGATGG + Intronic
924752481 1:246907825-246907847 TTCATTTGCAGCTTGAATAATGG - Intronic
924822933 1:247511947-247511969 CTCATTTCAACCTTGATGAATGG + Intronic
1063127760 10:3150521-3150543 CTCACTTGCACCTTGAGGACGGG - Intronic
1065173669 10:23056350-23056372 GTCATTTACAGCTTAAGGGGAGG + Intergenic
1065626759 10:27637838-27637860 TTCATTTACATCTTGTGGCATGG + Intergenic
1065762766 10:28998090-28998112 CTCAGTTCCATTTTGAGGAATGG + Intergenic
1068659133 10:59605310-59605332 CTCATTTGCAGAATGAGGACAGG - Intergenic
1068708745 10:60108247-60108269 CTCATTTACAGGGGGAGGATTGG + Intronic
1068919762 10:62471045-62471067 TTAATTTACAGTTTGAGGTAAGG + Intronic
1069128068 10:64662865-64662887 CTCATTTGCAGCTAGATGGATGG - Intergenic
1069818922 10:71215676-71215698 CTCATTAAAAGCTCCAGGAAGGG - Intronic
1070467342 10:76736845-76736867 CTCACTTACAGCTTCATGACTGG + Intergenic
1070718673 10:78741211-78741233 CTCATCTACAGCTTGAGCTTTGG + Intergenic
1071686221 10:87760463-87760485 TTCCTGTACAGCTTGTGGAACGG + Intronic
1073663814 10:105507855-105507877 TTCATTTAGAGCTTAAGAAAAGG + Intergenic
1074099736 10:110345402-110345424 CTCTTTCAAAGCTTGAGGTAGGG - Intergenic
1074601367 10:114917165-114917187 CTCATTTCCAGCAGGAGGAAGGG + Intergenic
1075003217 10:118812923-118812945 CTCAGTAACTGCTTGTGGAACGG - Intergenic
1080783594 11:35454180-35454202 CTCATGTAGAAGTTGAGGAATGG - Intronic
1081500756 11:43664293-43664315 CTCATTTGCAGTTTGAGTAAGGG + Intronic
1083495696 11:63050925-63050947 CTCAGTTCCATTTTGAGGAATGG - Intergenic
1083752556 11:64768577-64768599 TTCATTCCCAGTTTGAGGAAAGG + Intronic
1086981301 11:93200375-93200397 CTCTTTTACAGATGGAGAAATGG + Intergenic
1087674801 11:101148387-101148409 CTTATTTATGGCATGAGGAATGG + Intergenic
1088609900 11:111566909-111566931 CTCTTTTTGAGCCTGAGGAAGGG - Intergenic
1091555334 12:1569197-1569219 TTCCTTTCCAGGTTGAGGAAAGG + Intronic
1092069639 12:5622273-5622295 CTCATTTCCAGTTGGAGGAAAGG - Intronic
1093016534 12:14161115-14161137 CTTGTTTACTGTTTGAGGAAAGG + Intergenic
1093353333 12:18130846-18130868 GACATGTACAGCTGGAGGAAGGG - Intronic
1095910313 12:47419327-47419349 CTCAATTTCTGCCTGAGGAATGG + Intergenic
1097518062 12:60631419-60631441 CTCATATACAGCTGGAGGTAAGG - Intergenic
1101491201 12:105211453-105211475 ATCATTTACTGCTTTATGAAGGG - Intronic
1101527043 12:105540339-105540361 CTCCTCTACAGCTGGTGGAAAGG + Intergenic
1102432011 12:112890990-112891012 TTGACTTACAGCTTGACGAATGG - Exonic
1102616071 12:114155376-114155398 ATCAGTTACAACTTCAGGAAAGG + Intergenic
1103014107 12:117480637-117480659 CTCAGTTAGAGCTTGGGGTATGG - Intronic
1103945314 12:124522950-124522972 CTCGTGGGCAGCTTGAGGAAAGG + Intronic
1104548348 12:129732615-129732637 AGCATTTACACCTTGTGGAAGGG - Intronic
1109243026 13:59914447-59914469 GTCATGTACATCTTTAGGAATGG - Intronic
1109748681 13:66661391-66661413 CTCATTCACAGCTTGTGAAAAGG - Intronic
1112749888 13:102571411-102571433 CTCATTTGCAATTTTAGGAAAGG + Intergenic
1116210762 14:41940199-41940221 TTTATTTAAAGTTTGAGGAATGG + Intergenic
1117417234 14:55508302-55508324 ATCATTAACAGCTTAAAGAAAGG - Intergenic
1117431417 14:55667224-55667246 CTCATCTTCTGCTTTAGGAAAGG + Exonic
1118785064 14:69038808-69038830 CTCATTTACAGATGGGGAAATGG - Intergenic
1119727424 14:76930137-76930159 CACATTCAAAGCTGGAGGAAGGG - Intergenic
1120299698 14:82691226-82691248 CTCATGAACAGGTGGAGGAAAGG - Intergenic
1126719621 15:51563844-51563866 CTCATTAATAGATTGAGGTAAGG - Intronic
1128664758 15:69530030-69530052 CTCTTTTACAGATGGAGAAATGG + Intergenic
1131247479 15:90808081-90808103 CACATTCACAGCTGGAGGTAAGG - Intronic
1131421073 15:92305842-92305864 CTCATTTTCCGGATGAGGAAGGG - Intergenic
1132042846 15:98539508-98539530 CTCATGTACAGTGTGAGGTATGG - Intergenic
1134634594 16:15782784-15782806 GTCATTTACATCATGATGAATGG + Intronic
1135585615 16:23668705-23668727 CTCATGTGCAGCAGGAGGAAAGG - Exonic
1135721330 16:24820994-24821016 CTCATTTTCAGCTTGAAGATGGG - Intronic
1136103768 16:28014114-28014136 CTCATCTAGAGCCTGAGAAAGGG + Intronic
1138807048 16:60102360-60102382 CTCATTACCATCTAGAGGAAAGG + Intergenic
1139417999 16:66830214-66830236 CTCATGACCAGCTTGGGGAAAGG + Intronic
1139901988 16:70335403-70335425 CTCTTTGACAGCAGGAGGAATGG + Intronic
1141587931 16:85047539-85047561 TTCCTTTCCAGCTGGAGGAACGG - Intronic
1141831252 16:86511026-86511048 CCCATGTACAGCATGATGAACGG + Exonic
1142411132 16:89917815-89917837 CCCATTTACAGCTGCAGGAAAGG - Intronic
1142966566 17:3585572-3585594 CTCCTGTACAGCCTGAGGCAGGG + Intronic
1149227758 17:54495243-54495265 CTCATTTACACCTGCCGGAAAGG + Intergenic
1149437315 17:56644318-56644340 CTCATTTTCAGGTAGGGGAAGGG - Intergenic
1150116711 17:62557486-62557508 CTCATTCAAAGATGGAGGAAAGG - Intronic
1150281752 17:63932961-63932983 CTCTTTCACAGCATGAGGAAGGG - Intergenic
1151086019 17:71381643-71381665 CTCAGTTACAGTTTCAGGAATGG + Intergenic
1151390870 17:73785942-73785964 CTCATTCCCAGCCTGGGGAACGG - Intergenic
1155218742 18:23665646-23665668 CTAATTTACGGCTGGAGGCATGG + Intergenic
1157427691 18:47598149-47598171 CTCATTGACAGCTGTAGGGATGG - Intergenic
1157913544 18:51641769-51641791 CTCCTCTACAGCCAGAGGAAAGG + Intergenic
1158615760 18:58985154-58985176 CTCAGTTCCATTTTGAGGAATGG + Exonic
1158827503 18:61239957-61239979 CTTATTTCCAGCTTGGAGAAAGG + Intergenic
1163317545 19:16551640-16551662 CTCTTTTACGGCTTCATGAAAGG - Exonic
1164602708 19:29573813-29573835 ATCAATTACCGCTTCAGGAATGG - Intergenic
1164692039 19:30218345-30218367 CACATTTACAGCATGGGAAAGGG + Intergenic
1165709623 19:38001223-38001245 CTCAAGTACACCTTAAGGAAGGG - Intronic
1167019987 19:46866348-46866370 CTCATTTACAGATGGAGGAATGG + Intergenic
1168510491 19:56969698-56969720 CTCATTTACAACTGGAGCCAGGG + Intergenic
926952868 2:18262443-18262465 CTCAGTTCCATTTTGAGGAATGG + Intronic
931164117 2:59727418-59727440 CTCATTTACATAATGATGAATGG + Intergenic
932012672 2:67993972-67993994 CTCATTTACAGCTGGATCAGGGG + Intergenic
932088059 2:68779886-68779908 CTCATGCTGAGCTTGAGGAAAGG + Intronic
932375166 2:71228606-71228628 CTCCTGTACAGCCTGAGGAACGG + Intergenic
933284358 2:80369111-80369133 CTCTTTGGAAGCTTGAGGAAGGG - Intronic
934745945 2:96759980-96760002 CCCATTTACAGATGGAGAAATGG + Intergenic
936149993 2:110011474-110011496 CTCAATTCCATTTTGAGGAATGG + Intergenic
936194683 2:110359895-110359917 CTCAATTCCATTTTGAGGAATGG - Intergenic
938418713 2:131125993-131126015 TTCATTAACAGATTGAAGAAGGG + Intronic
938766579 2:134463927-134463949 TTCATCTGGAGCTTGAGGAAGGG + Intronic
938892592 2:135720603-135720625 CACATTTACTGATTTAGGAAGGG + Intronic
939966661 2:148617017-148617039 CTAATTTACAGCCCCAGGAATGG - Intergenic
939967174 2:148621901-148621923 ATCATGTACAGCATGAGGGAAGG + Intergenic
941006036 2:160248020-160248042 CTAATTGACAGCTTGAGTCAAGG - Intronic
941766002 2:169297202-169297224 CTCATTAACATCTTTAGCAATGG - Intronic
942929951 2:181478272-181478294 CTAATGTACAGCATGAGGACTGG + Intronic
944036858 2:195304626-195304648 CTCCTGTACAGCCTGTGGAACGG + Intergenic
944354838 2:198774902-198774924 CTGATTGAAAGCCTGAGGAAGGG - Intergenic
945489244 2:210435448-210435470 CTCATTTTCAGTTTGCTGAATGG - Exonic
947180225 2:227404871-227404893 CTCACTTACTTCTTGAGAAATGG + Intergenic
1169707273 20:8519527-8519549 GTGATTGACAGTTTGAGGAAGGG + Intronic
1172179384 20:32991851-32991873 CTCCATTACAGCTTCAGTAAAGG + Intronic
1173000636 20:39102764-39102786 TTCATTAACAGTTTGAGGCACGG + Intergenic
1173622630 20:44448384-44448406 TTCATTTACAGTGTGGGGAATGG + Intergenic
1174892235 20:54408302-54408324 CACATTTACTGCTTGAAGAAAGG - Intergenic
1175712343 20:61231409-61231431 CTCCTTCACAGCATGGGGAATGG - Intergenic
1176691001 21:9908636-9908658 CTAATTTACACATTGGGGAAAGG - Intergenic
1178180764 21:30158695-30158717 CTCATCTACAGAGTGTGGAAAGG - Intergenic
1178475566 21:32934374-32934396 CTCATTAACTGCCTGAAGAAGGG + Intergenic
1178676623 21:34636688-34636710 CTCATCTACAGCTTTAATAAAGG - Intergenic
1179039886 21:37793249-37793271 TTCATTTACATATGGAGGAATGG + Intronic
1180582758 22:16856899-16856921 CTCAATTCCATTTTGAGGAATGG - Intergenic
1182804988 22:33061831-33061853 ATCATTTAAAGCTGGAGAAATGG + Intergenic
949360103 3:3222463-3222485 CTCCTTTACAGATGGAGAAATGG + Intergenic
954164778 3:48748028-48748050 CTATTTAATAGCTTGAGGAAGGG - Exonic
955519209 3:59758797-59758819 GGCATTAACAGCTTGAGAAATGG + Intronic
956865354 3:73363710-73363732 CTCATGGAAAGCTGGAGGAAGGG + Intergenic
957045431 3:75370456-75370478 TTCATCTACAGCCTGAGAAACGG - Intergenic
961274071 3:125713004-125713026 TTCATCTACAGCCTGAGAAACGG + Intergenic
961276958 3:125735161-125735183 TTCATCTACAGCCTGAGAAACGG + Intergenic
961701501 3:128748283-128748305 CTCATTTTCAGGTCGAGTAAGGG + Intronic
961877467 3:130034576-130034598 TTCATCTACAGCCTGAGAAACGG - Intergenic
963030596 3:140970972-140970994 CTCGGTTACAGCTTGATGCAAGG + Exonic
963442407 3:145356563-145356585 CTCATTAACAGCTGGAGAGAAGG - Intergenic
963592357 3:147277466-147277488 CTCATGTACTGCTTGTCGAAAGG + Intergenic
965541540 3:169876601-169876623 GTCATTTACAACTTAAGTAAAGG + Intergenic
966195270 3:177307437-177307459 CTCAATTACAGCTGCAGAAATGG + Intergenic
967432908 3:189408228-189408250 CTCATATACTGCTAGTGGAAGGG + Intergenic
968284821 3:197502333-197502355 CTCATTAACAGGATGAAGAAGGG - Intergenic
971783981 4:31076784-31076806 CACATTAACAGATTAAGGAAGGG + Intronic
972353672 4:38260506-38260528 CATATTAACAGCTTGAGCAAAGG + Intergenic
972363144 4:38347556-38347578 CTCATGTACATTTTCAGGAAGGG - Intergenic
973935048 4:55837158-55837180 CTTATTTACAGTTCGAGCAAAGG - Intergenic
974059022 4:57013299-57013321 CTTATTTACAGCTTGAAGTCAGG + Intronic
974811626 4:66953448-66953470 CTGATTTACTGCTTTTGGAATGG + Intergenic
975110946 4:70625892-70625914 CGCATTTACAGCCTGAGAACAGG + Intergenic
975812977 4:78188851-78188873 GTCATTTATAGCATGAGGACGGG - Intronic
975849706 4:78559484-78559506 CTAATTTACAAAATGAGGAAAGG + Intronic
976757776 4:88516604-88516626 CTCATTTAGAGCTGGTGGGAAGG + Intergenic
976952824 4:90854219-90854241 CTAATTTAGATCTTGAGGAAAGG + Intronic
978100519 4:104834755-104834777 CTCAGTTATAGCTAGAGGAGGGG - Intergenic
979926716 4:126576603-126576625 TTCTTTTTCAGTTTGAGGAAAGG + Intergenic
980363577 4:131768809-131768831 CTAATTTACACATTGGGGAAAGG - Intergenic
981380749 4:144069032-144069054 ATCATTTACTGTTTGAGGATTGG - Intergenic
982825501 4:159999412-159999434 CCAATTTATAGCTTTAGGAAGGG + Intergenic
984848979 4:184136505-184136527 CTCATTGCCAGCTAGAGTAAAGG - Intronic
986223393 5:5790900-5790922 AGCATTTTCAGCTTGAGGACAGG - Intergenic
986342045 5:6797928-6797950 TTCATTTACAGGTTTAGTAAGGG - Intergenic
988318474 5:29661662-29661684 CTCATTTACTGATGGAAGAACGG - Intergenic
991155608 5:63431305-63431327 TTCATTAGAAGCTTGAGGAAAGG + Intergenic
992488642 5:77219699-77219721 CTCATTTTCAGCTTAAAAAATGG + Intronic
992959227 5:81941706-81941728 CTAGTTTACTGCTGGAGGAAGGG + Intergenic
993147261 5:84111188-84111210 TTCCTATACAGCTTGTGGAATGG + Intronic
994767179 5:103933554-103933576 CCTATTTACAGCTTCAAGAAAGG + Intergenic
998072257 5:139207310-139207332 CTCATTTTTAGCTGGAGGGAGGG - Intronic
1002700931 5:181124418-181124440 CTCATTTACAGCTTGAGGAATGG - Exonic
1003653980 6:7988509-7988531 CTCATTTCCAGCATGAAGAATGG - Intronic
1010305774 6:74320301-74320323 CTTATTTACATGTTGATGAATGG - Intergenic
1010375065 6:75158327-75158349 CACATTCACAGCCTGAGAAAAGG + Intronic
1010452509 6:76018672-76018694 CTCAGTCACAGCTTGAGGTGTGG + Intronic
1015190846 6:130470587-130470609 CTGGTTGACAGCTAGAGGAAAGG + Intergenic
1017754895 6:157521146-157521168 CTCATTTACAGATGGAGAAGCGG + Intronic
1017767799 6:157621141-157621163 ATCATTTACAGTCTAAGGAAGGG + Intronic
1018440148 6:163804980-163805002 CTCATCTCCATTTTGAGGAAGGG - Intergenic
1018741357 6:166731647-166731669 GTCATTTACCTCCTGAGGAATGG - Intronic
1022156113 7:27663116-27663138 CTCATTTACAGCCTGCGGGCGGG + Intergenic
1022387392 7:29914582-29914604 CTGAATTACAGCTTGAGCATGGG - Exonic
1022767827 7:33434793-33434815 CTTATTTGCATCTTGAAGAATGG + Intronic
1022842866 7:34181396-34181418 GTCATTGAAAACTTGAGGAAAGG + Intergenic
1022979982 7:35595316-35595338 CTCATTTTCCGGATGAGGAAAGG - Intergenic
1024486486 7:49925897-49925919 CTCATGTTGAGCTTGGGGAAGGG + Intronic
1026290607 7:69002481-69002503 ATCATTGACTGGTTGAGGAAAGG + Intergenic
1028023755 7:85809558-85809580 TTCTTTTACAGTTTGAGAAAAGG - Intergenic
1029268341 7:99359899-99359921 CTCATTTCCAGCTCGTGGTAGGG + Intronic
1029333655 7:99881502-99881524 CTAATTGACATCTTGAGTAATGG - Intronic
1033736948 7:144231963-144231985 CTGATTTACAGCCTGAGGAACGG - Exonic
1033746109 7:144318983-144319005 CTGATTTACAGCCTGAGGAACGG + Exonic
1034923858 7:155104993-155105015 CTCAATTCCATTTTGAGGAATGG - Intergenic
1037760869 8:21740661-21740683 GGCATTTAAAGCTAGAGGAATGG - Intronic
1038835713 8:31120063-31120085 CTGATTTACAGATTAAGGACTGG - Intronic
1039168066 8:34708574-34708596 CTCACTTTAAGGTTGAGGAAGGG - Intergenic
1042220474 8:66468252-66468274 TTCATTTACTGTTTCAGGAAAGG + Exonic
1042501729 8:69515892-69515914 CTCATTCAGAACTTGAGTAAAGG - Intronic
1043136760 8:76536955-76536977 TTTTTTTACAGCTTGAGAAATGG + Intergenic
1044034173 8:87277237-87277259 CTCCTTGACAGCTTGAGAACAGG - Intronic
1044334968 8:90971097-90971119 CTCATTAAGACCTTGAGAAAAGG + Exonic
1048032940 8:130650154-130650176 CTCATTTTCAGCTCCAGGGATGG - Intergenic
1048682898 8:136865941-136865963 CTCAGTTCCATTTTGAGGAATGG + Intergenic
1050583787 9:7088761-7088783 CCCATTGACAGCTTGTGGAGTGG - Intergenic
1053627741 9:39893148-39893170 CTAATTTACACATTGGGGAAAGG - Intergenic
1053778255 9:41572867-41572889 CTAATTTACACATTGGGGAAAGG + Intergenic
1054216147 9:62357553-62357575 CTAATTTACACATTGGGGAAAGG + Intergenic
1054671334 9:67797789-67797811 CTAATTTACACATTGGGGAAAGG - Intergenic
1054877102 9:70108274-70108296 CTGACTTACAGGCTGAGGAATGG + Exonic
1056807487 9:89740234-89740256 GTCATTTTCTGCTTCAGGAAAGG + Intergenic
1059613533 9:115924571-115924593 CTGCTTTACAGATTGGGGAAAGG + Intergenic
1059655703 9:116355405-116355427 CCCATTTACAGCTGGAGACAGGG - Intronic
1060324714 9:122602859-122602881 TTCATTTAGAGTTTGAGGACTGG + Intergenic
1060325949 9:122615599-122615621 TTCATCTACAGCCTGAGGAATGG + Exonic
1062386858 9:136315901-136315923 CTCATTTAGAGCCTGGGGTAAGG - Intergenic
1186395647 X:9206303-9206325 CTCATTTAAGTCTTGAGGCAGGG + Intergenic
1188954207 X:36415054-36415076 CACATTTACACTTTGAGGCATGG - Intergenic
1189608840 X:42709637-42709659 CTCCCCTACAGCTTCAGGAAGGG + Intergenic
1189858508 X:45248149-45248171 CTTTTTTTCTGCTTGAGGAAAGG - Intergenic
1192358671 X:70425167-70425189 CTCATAGACAGCTTGGGGGAAGG + Intronic
1192735611 X:73846820-73846842 CACATTAACAGTTTGAGAAAGGG + Intergenic
1193016393 X:76738662-76738684 ATCATTTTCTGCTTGAGAAAAGG + Intergenic
1193888673 X:87015949-87015971 CTCATTTACAGCAACATGAATGG + Intergenic
1194488771 X:94520647-94520669 CTCATATATGGCTAGAGGAAAGG + Intergenic
1196806291 X:119589851-119589873 GTCATTAACAACTTGAAGAAAGG - Exonic
1199179833 X:144840934-144840956 CTCATTAACATATTGAGCAAAGG - Intergenic
1199345517 X:146734145-146734167 TTCTTTTACAGCTTGCAGAATGG + Intergenic
1200378217 X:155806707-155806729 CTCATTAACAGCTAGAGAAGTGG + Intergenic
1200765546 Y:7077792-7077814 CTCATTTAGAGACTGAGGAAGGG + Intronic
1200879788 Y:8201143-8201165 CTCATATTCTGCTGGAGGAATGG + Intergenic
1201548226 Y:15189851-15189873 CTCGTTTGCACCTTGATGAAGGG - Intergenic
1201990998 Y:20026043-20026065 CTCATGTTCACCTTGAGGCAGGG + Intergenic