ID: 1002700944

View in Genome Browser
Species Human (GRCh38)
Location 5:181124480-181124502
Sequence GGCCACCTTGTCATGGCTAG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 1, 2: 2, 3: 5, 4: 86}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002700944 Original CRISPR GGCCACCTTGTCATGGCTAG GGG Exonic
900457047 1:2781182-2781204 GGCCAACTTTTCATATCTAGGGG + Intronic
901293174 1:8140414-8140436 GGCCACCCAGTCATGATTAGTGG + Intergenic
903826431 1:26148942-26148964 AGCCTCCATGTCATGGCCAGAGG - Intergenic
912567404 1:110598132-110598154 GGATACCTTGCCAAGGCTAGGGG + Intronic
915296657 1:154926153-154926175 GGCTATCTTCTCATGGCCAGTGG - Intronic
915513519 1:156400115-156400137 GGCCACCCTGTCTGGGCCAGTGG + Intergenic
920962891 1:210680039-210680061 GGCTATCTTGTCATGTCCAGTGG + Exonic
922930070 1:229382091-229382113 GGGCACCTTGACCTGGCCAGAGG + Intergenic
924890445 1:248272999-248273021 CACAACCTTGTCATGGTTAGTGG + Exonic
1070718291 10:78738626-78738648 GGCCCCCTTATCATTGCCAGAGG + Intergenic
1075553054 10:123408032-123408054 GGCCACCTTGCTGTGGCCAGTGG + Intergenic
1079173076 11:18114757-18114779 TGCCACTTTATTATGGCTAGTGG + Intronic
1079983598 11:27177533-27177555 AGCCACCTTTTTGTGGCTAGGGG + Intergenic
1081711062 11:45215723-45215745 GGTCACCTGGTCATGGCTAGAGG - Intronic
1088743652 11:112786750-112786772 GGCTGCCTTGTGGTGGCTAGTGG + Intergenic
1092005074 12:5062260-5062282 AGCCACTTTTCCATGGCTAGAGG + Intergenic
1100814606 12:98374199-98374221 GCCCACCTTGTGGTGGCAAGGGG - Intergenic
1102461003 12:113099608-113099630 GGCCTCCTTGGTATGGATAGAGG + Exonic
1104105622 12:125656414-125656436 GGCTGCCACGTCATGGCTAGAGG - Exonic
1105349772 13:19604530-19604552 CGCCAGCTTGTCAGGGCTGGTGG + Intergenic
1107419842 13:40236088-40236110 TGCCATCTTGTTTTGGCTAGGGG - Intergenic
1114210497 14:20609896-20609918 GGCAACCTTGTCAGGTCTAACGG - Intergenic
1114744140 14:25128812-25128834 AGCCACATTATCATGGCCAGTGG - Intergenic
1116864196 14:50018113-50018135 GGATTCCTCGTCATGGCTAGTGG - Intergenic
1116911546 14:50471388-50471410 GGCCTGCAGGTCATGGCTAGGGG - Intronic
1118815118 14:69306749-69306771 GGGCACCCTGCCATGTCTAGGGG + Intronic
1120743780 14:88135554-88135576 GGACAACTTATGATGGCTAGTGG - Intergenic
1122400879 14:101466642-101466664 GACCACCTTGGCCTGGCTGGGGG - Intergenic
1122938165 14:104969476-104969498 GGCCACCCTGCCATGGCTTCTGG + Intronic
1129159725 15:73740535-73740557 GCCCGCCTTGTCACTGCTAGAGG + Exonic
1130837312 15:87663683-87663705 GGCTACCTGCCCATGGCTAGTGG + Intergenic
1131145654 15:90009868-90009890 GGCCACCTACTCATGCCCAGTGG + Intronic
1132337337 15:101056794-101056816 GGCCACCTTGTGAAGGCCACTGG + Intronic
1133555177 16:6899794-6899816 GGACACCTTTTCATTGCAAGAGG + Intronic
1134022903 16:10933689-10933711 GGGAACCTTCTCAAGGCTAGGGG + Intronic
1143543109 17:7581176-7581198 TCCCAGCTTGTCATGGCTACAGG + Intronic
1144673611 17:17146898-17146920 GGCCACATGGCCATGGCTTGCGG + Intronic
1145994932 17:29099726-29099748 GGGCACCTTGGCACGGCTGGAGG - Exonic
1146000056 17:29125618-29125640 GGCCACATTGTCCTGCCTCGAGG - Intronic
1147241577 17:39094154-39094176 GGCCACCTTCTCATGGCCATTGG - Intronic
1148443809 17:47725811-47725833 GGCCCCTCTGTCAGGGCTAGGGG - Intergenic
1152058661 17:78052139-78052161 GGCCAGGCTGTCATGGCCAGAGG + Intronic
1152390485 17:80001247-80001269 GGCCACCTTGGCTTGGGCAGGGG + Intronic
1155612654 18:27684346-27684368 GGCCAAAATGTCTTGGCTAGAGG + Intergenic
1156625922 18:38909035-38909057 GGCCACCTTCTGATGCCTATTGG + Intergenic
1159622578 18:70655591-70655613 GGCAACATTTTCATGGCAAGTGG + Intergenic
1162981943 19:14246156-14246178 AGCCACCTTGCCAGGCCTAGTGG - Intergenic
1163491633 19:17620316-17620338 GGCCATCTGGTCATTCCTAGAGG + Intronic
1163738915 19:18998875-18998897 GGCCACTTTCTCATGGCAAGGGG - Intronic
926076685 2:9948832-9948854 GGACACCTTGTCCAGCCTAGAGG + Intergenic
927338992 2:21959207-21959229 GGCCAGCGTGTCATGTCTCGAGG + Intergenic
929889827 2:45909827-45909849 CCCCACCTTGTCATGGGCAGTGG - Intronic
931813640 2:65878948-65878970 GCCCACCTGGTCAGGGCAAGAGG + Intergenic
933289633 2:80423857-80423879 GGCCACCTTTTTATTGCTATTGG - Intronic
941609472 2:167643437-167643459 TGCCACCTTGTCATGTTAAGTGG + Intergenic
942718626 2:178923476-178923498 GTCACCCTTGTCAAGGCTAGAGG + Intronic
945583821 2:211631153-211631175 GGAGACATTGTCATGACTAGAGG - Intronic
946404614 2:219485566-219485588 GGCCACCTTGACAAACCTAGTGG + Intronic
948079523 2:235194166-235194188 GGCCACCAGGCCATGGGTAGTGG + Intergenic
948620751 2:239232736-239232758 GGCCACCTTGGCTTGGTGAGGGG - Intronic
1171391283 20:24803095-24803117 GGCCTCCTTGCCATGGCCATGGG - Intergenic
1172043117 20:32060079-32060101 GGCCACCATGTCCTGTCTGGAGG + Intronic
1173523210 20:43714004-43714026 AGAAACCTTGTCCTGGCTAGGGG + Intronic
1175359316 20:58395575-58395597 GGCAACCTTGTCTTGACTAATGG - Intronic
1175588709 20:60169644-60169666 GGCCACCTTGCCATCTCTGGAGG - Intergenic
1177768815 21:25491709-25491731 GGCCACCTTGAGTTGGCTATGGG + Intergenic
953043235 3:39273301-39273323 GACCACCTAGTGGTGGCTAGAGG - Intronic
954199345 3:49014902-49014924 GGCCACCATCTCGTGGCCAGTGG + Exonic
956253801 3:67262720-67262742 GGCAACCTGGACATGGGTAGTGG + Intergenic
963794399 3:149617176-149617198 GACCACCTTGTCATGGCACAAGG - Intronic
965337906 3:167450422-167450444 GGCCAGCTTGACATGGCTTCTGG - Intronic
966009433 3:175056503-175056525 ACCCACCTTGTCTTGGCAAGTGG - Intronic
967228302 3:187314054-187314076 GGCCACCCTGTCAGGGACAGAGG + Intergenic
969451785 4:7277987-7278009 GGATACCTTGTCATTGGTAGTGG + Intronic
972865630 4:43228657-43228679 GGCCACACAGTCATGGCTAAAGG + Intergenic
977235004 4:94497561-94497583 GGCTACCTTGACATTGCTATTGG + Intronic
987124132 5:14795215-14795237 GACTACCTTTTCATGGCTGGTGG - Intronic
992810639 5:80384882-80384904 AACCACATTGTCAGGGCTAGGGG - Intergenic
1001398868 5:171435097-171435119 GGCCACCTTGGCATGGCTCTGGG - Intronic
1002700944 5:181124480-181124502 GGCCACCTTGTCATGGCTAGGGG + Exonic
1002705149 5:181155745-181155767 GGCCACCTTGTCATGGCTGGGGG - Exonic
1007392196 6:41556006-41556028 GGCCACCTTGCCAGGGCCTGTGG + Intronic
1021088050 7:16447174-16447196 GGCCTTCTTGCCATGGCTTGTGG + Intergenic
1028463144 7:91118889-91118911 GGCCAGGCTGACATGGCTAGAGG - Intronic
1028714220 7:93946069-93946091 GGACACCTTGTCTTGGATATAGG - Intergenic
1029444841 7:100606039-100606061 GGCCACCTGGCCAGGGGTAGTGG + Intronic
1032257985 7:130312027-130312049 CGCCACCTTGTCCTGGGAAGGGG - Exonic
1039364302 8:36914292-36914314 GGTCACCTTATGATGGCTGGAGG + Intronic
1047860022 8:128955648-128955670 GGCATCCTTGTCATTGCTAGAGG + Intergenic
1059737767 9:117119402-117119424 GGCCTCCTTGTCCTGGCTACAGG - Intronic
1060196656 9:121628446-121628468 GGGCACCTGGTCCTGGCTATGGG + Intronic
1061169858 9:128946361-128946383 GGCCACCTTGGCCTGCCTGGTGG - Exonic
1187267860 X:17752310-17752332 GGCCACCCTGTTATAGCTTGTGG - Intronic
1187321435 X:18242070-18242092 GGCCACCCTGTAATAGCTTGTGG + Intronic
1199237885 X:145511377-145511399 AGCCAGCTTGTCATGGCTAGAGG - Intergenic