ID: 1002701291

View in Genome Browser
Species Human (GRCh38)
Location 5:181127072-181127094
Sequence GTGGAGAAACGGCAGCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002701291_1002701299 18 Left 1002701291 5:181127072-181127094 CCTTCCTGCTGCCGTTTCTCCAC No data
Right 1002701299 5:181127113-181127135 CACCCACAGGCTCCCGTATTTGG No data
1002701291_1002701297 5 Left 1002701291 5:181127072-181127094 CCTTCCTGCTGCCGTTTCTCCAC No data
Right 1002701297 5:181127100-181127122 TGGTGCCATCTGACACCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002701291 Original CRISPR GTGGAGAAACGGCAGCAGGA AGG (reversed) Intergenic
No off target data available for this crispr