ID: 1002703189

View in Genome Browser
Species Human (GRCh38)
Location 5:181141880-181141902
Sequence GAGTATACACAGTTTCAGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002703189_1002703190 -2 Left 1002703189 5:181141880-181141902 CCTAACTGAAACTGTGTATACTC No data
Right 1002703190 5:181141901-181141923 TCTTTCACCAAAATCTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002703189 Original CRISPR GAGTATACACAGTTTCAGTT AGG (reversed) Intergenic
No off target data available for this crispr