ID: 1002707198

View in Genome Browser
Species Human (GRCh38)
Location 5:181169979-181170001
Sequence GCCTCCTGCTCGGCCCCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002707191_1002707198 -5 Left 1002707191 5:181169961-181169983 CCAATGAATCCTCCCCCAGCCTC No data
Right 1002707198 5:181169979-181170001 GCCTCCTGCTCGGCCCCTGCAGG No data
1002707186_1002707198 25 Left 1002707186 5:181169931-181169953 CCCGAGCAAGCGTGGGGCCCAAG No data
Right 1002707198 5:181169979-181170001 GCCTCCTGCTCGGCCCCTGCAGG No data
1002707190_1002707198 7 Left 1002707190 5:181169949-181169971 CCAAGGCGAGTTCCAATGAATCC No data
Right 1002707198 5:181169979-181170001 GCCTCCTGCTCGGCCCCTGCAGG No data
1002707189_1002707198 8 Left 1002707189 5:181169948-181169970 CCCAAGGCGAGTTCCAATGAATC No data
Right 1002707198 5:181169979-181170001 GCCTCCTGCTCGGCCCCTGCAGG No data
1002707187_1002707198 24 Left 1002707187 5:181169932-181169954 CCGAGCAAGCGTGGGGCCCAAGG No data
Right 1002707198 5:181169979-181170001 GCCTCCTGCTCGGCCCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002707198 Original CRISPR GCCTCCTGCTCGGCCCCTGC AGG Intergenic
No off target data available for this crispr