ID: 1002707275

View in Genome Browser
Species Human (GRCh38)
Location 5:181170309-181170331
Sequence GCAGCGCCTTTCTTACGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002707275_1002707279 1 Left 1002707275 5:181170309-181170331 CCCGCCCGTAAGAAAGGCGCTGC No data
Right 1002707279 5:181170333-181170355 CTCACCCCATTCTACAGACGAGG No data
1002707275_1002707283 16 Left 1002707275 5:181170309-181170331 CCCGCCCGTAAGAAAGGCGCTGC No data
Right 1002707283 5:181170348-181170370 AGACGAGGAACCGCCCCTCCCGG No data
1002707275_1002707284 17 Left 1002707275 5:181170309-181170331 CCCGCCCGTAAGAAAGGCGCTGC No data
Right 1002707284 5:181170349-181170371 GACGAGGAACCGCCCCTCCCGGG No data
1002707275_1002707285 18 Left 1002707275 5:181170309-181170331 CCCGCCCGTAAGAAAGGCGCTGC No data
Right 1002707285 5:181170350-181170372 ACGAGGAACCGCCCCTCCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002707275 Original CRISPR GCAGCGCCTTTCTTACGGGC GGG (reversed) Intergenic