ID: 1002710136

View in Genome Browser
Species Human (GRCh38)
Location 5:181190399-181190421
Sequence ATCACCCCACTGTAGAAGTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002710136_1002710141 -7 Left 1002710136 5:181190399-181190421 CCCGACTTCTACAGTGGGGTGAT No data
Right 1002710141 5:181190415-181190437 GGGTGATCTTCCTGTGGGGCAGG No data
1002710136_1002710146 18 Left 1002710136 5:181190399-181190421 CCCGACTTCTACAGTGGGGTGAT No data
Right 1002710146 5:181190440-181190462 TTTCGGGGTCCACGAGTCCGAGG No data
1002710136_1002710142 1 Left 1002710136 5:181190399-181190421 CCCGACTTCTACAGTGGGGTGAT No data
Right 1002710142 5:181190423-181190445 TTCCTGTGGGGCAGGCGTTTCGG No data
1002710136_1002710149 27 Left 1002710136 5:181190399-181190421 CCCGACTTCTACAGTGGGGTGAT No data
Right 1002710149 5:181190449-181190471 CCACGAGTCCGAGGAGCCCCGGG No data
1002710136_1002710147 26 Left 1002710136 5:181190399-181190421 CCCGACTTCTACAGTGGGGTGAT No data
Right 1002710147 5:181190448-181190470 TCCACGAGTCCGAGGAGCCCCGG No data
1002710136_1002710143 2 Left 1002710136 5:181190399-181190421 CCCGACTTCTACAGTGGGGTGAT No data
Right 1002710143 5:181190424-181190446 TCCTGTGGGGCAGGCGTTTCGGG No data
1002710136_1002710145 3 Left 1002710136 5:181190399-181190421 CCCGACTTCTACAGTGGGGTGAT No data
Right 1002710145 5:181190425-181190447 CCTGTGGGGCAGGCGTTTCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002710136 Original CRISPR ATCACCCCACTGTAGAAGTC GGG (reversed) Intergenic