ID: 1002710137

View in Genome Browser
Species Human (GRCh38)
Location 5:181190400-181190422
Sequence GATCACCCCACTGTAGAAGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002710137_1002710143 1 Left 1002710137 5:181190400-181190422 CCGACTTCTACAGTGGGGTGATC No data
Right 1002710143 5:181190424-181190446 TCCTGTGGGGCAGGCGTTTCGGG No data
1002710137_1002710141 -8 Left 1002710137 5:181190400-181190422 CCGACTTCTACAGTGGGGTGATC No data
Right 1002710141 5:181190415-181190437 GGGTGATCTTCCTGTGGGGCAGG No data
1002710137_1002710149 26 Left 1002710137 5:181190400-181190422 CCGACTTCTACAGTGGGGTGATC No data
Right 1002710149 5:181190449-181190471 CCACGAGTCCGAGGAGCCCCGGG No data
1002710137_1002710147 25 Left 1002710137 5:181190400-181190422 CCGACTTCTACAGTGGGGTGATC No data
Right 1002710147 5:181190448-181190470 TCCACGAGTCCGAGGAGCCCCGG No data
1002710137_1002710142 0 Left 1002710137 5:181190400-181190422 CCGACTTCTACAGTGGGGTGATC No data
Right 1002710142 5:181190423-181190445 TTCCTGTGGGGCAGGCGTTTCGG No data
1002710137_1002710146 17 Left 1002710137 5:181190400-181190422 CCGACTTCTACAGTGGGGTGATC No data
Right 1002710146 5:181190440-181190462 TTTCGGGGTCCACGAGTCCGAGG No data
1002710137_1002710145 2 Left 1002710137 5:181190400-181190422 CCGACTTCTACAGTGGGGTGATC No data
Right 1002710145 5:181190425-181190447 CCTGTGGGGCAGGCGTTTCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002710137 Original CRISPR GATCACCCCACTGTAGAAGT CGG (reversed) Intergenic