ID: 1002710144

View in Genome Browser
Species Human (GRCh38)
Location 5:181190425-181190447
Sequence CCCCGAAACGCCTGCCCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002710144_1002710155 29 Left 1002710144 5:181190425-181190447 CCTGTGGGGCAGGCGTTTCGGGG No data
Right 1002710155 5:181190477-181190499 TAGTGCCCGAACGTGCTGGCAGG No data
1002710144_1002710146 -8 Left 1002710144 5:181190425-181190447 CCTGTGGGGCAGGCGTTTCGGGG No data
Right 1002710146 5:181190440-181190462 TTTCGGGGTCCACGAGTCCGAGG No data
1002710144_1002710147 0 Left 1002710144 5:181190425-181190447 CCTGTGGGGCAGGCGTTTCGGGG No data
Right 1002710147 5:181190448-181190470 TCCACGAGTCCGAGGAGCCCCGG No data
1002710144_1002710154 25 Left 1002710144 5:181190425-181190447 CCTGTGGGGCAGGCGTTTCGGGG No data
Right 1002710154 5:181190473-181190495 GCGCTAGTGCCCGAACGTGCTGG No data
1002710144_1002710149 1 Left 1002710144 5:181190425-181190447 CCTGTGGGGCAGGCGTTTCGGGG No data
Right 1002710149 5:181190449-181190471 CCACGAGTCCGAGGAGCCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002710144 Original CRISPR CCCCGAAACGCCTGCCCCAC AGG (reversed) Intergenic
No off target data available for this crispr