ID: 1002710148

View in Genome Browser
Species Human (GRCh38)
Location 5:181190449-181190471
Sequence CCCGGGGCTCCTCGGACTCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002710148_1002710155 5 Left 1002710148 5:181190449-181190471 CCACGAGTCCGAGGAGCCCCGGG No data
Right 1002710155 5:181190477-181190499 TAGTGCCCGAACGTGCTGGCAGG No data
1002710148_1002710158 12 Left 1002710148 5:181190449-181190471 CCACGAGTCCGAGGAGCCCCGGG No data
Right 1002710158 5:181190484-181190506 CGAACGTGCTGGCAGGCTCCTGG No data
1002710148_1002710154 1 Left 1002710148 5:181190449-181190471 CCACGAGTCCGAGGAGCCCCGGG No data
Right 1002710154 5:181190473-181190495 GCGCTAGTGCCCGAACGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002710148 Original CRISPR CCCGGGGCTCCTCGGACTCG TGG (reversed) Intergenic