ID: 1002710149

View in Genome Browser
Species Human (GRCh38)
Location 5:181190449-181190471
Sequence CCACGAGTCCGAGGAGCCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002710136_1002710149 27 Left 1002710136 5:181190399-181190421 CCCGACTTCTACAGTGGGGTGAT No data
Right 1002710149 5:181190449-181190471 CCACGAGTCCGAGGAGCCCCGGG No data
1002710137_1002710149 26 Left 1002710137 5:181190400-181190422 CCGACTTCTACAGTGGGGTGATC No data
Right 1002710149 5:181190449-181190471 CCACGAGTCCGAGGAGCCCCGGG No data
1002710144_1002710149 1 Left 1002710144 5:181190425-181190447 CCTGTGGGGCAGGCGTTTCGGGG No data
Right 1002710149 5:181190449-181190471 CCACGAGTCCGAGGAGCCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002710149 Original CRISPR CCACGAGTCCGAGGAGCCCC GGG Intergenic