ID: 1002710150

View in Genome Browser
Species Human (GRCh38)
Location 5:181190457-181190479
Sequence CTAGCGCTCCCGGGGCTCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002710150_1002710155 -3 Left 1002710150 5:181190457-181190479 CCGAGGAGCCCCGGGAGCGCTAG No data
Right 1002710155 5:181190477-181190499 TAGTGCCCGAACGTGCTGGCAGG No data
1002710150_1002710161 29 Left 1002710150 5:181190457-181190479 CCGAGGAGCCCCGGGAGCGCTAG No data
Right 1002710161 5:181190509-181190531 TCTCCCGAGCGAATCCATCCCGG No data
1002710150_1002710158 4 Left 1002710150 5:181190457-181190479 CCGAGGAGCCCCGGGAGCGCTAG No data
Right 1002710158 5:181190484-181190506 CGAACGTGCTGGCAGGCTCCTGG No data
1002710150_1002710154 -7 Left 1002710150 5:181190457-181190479 CCGAGGAGCCCCGGGAGCGCTAG No data
Right 1002710154 5:181190473-181190495 GCGCTAGTGCCCGAACGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002710150 Original CRISPR CTAGCGCTCCCGGGGCTCCT CGG (reversed) Intergenic