ID: 1002710154

View in Genome Browser
Species Human (GRCh38)
Location 5:181190473-181190495
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002710150_1002710154 -7 Left 1002710150 5:181190457-181190479 CCGAGGAGCCCCGGGAGCGCTAG No data
Right 1002710154 5:181190473-181190495 GCGCTAGTGCCCGAACGTGCTGG No data
1002710148_1002710154 1 Left 1002710148 5:181190449-181190471 CCACGAGTCCGAGGAGCCCCGGG No data
Right 1002710154 5:181190473-181190495 GCGCTAGTGCCCGAACGTGCTGG No data
1002710144_1002710154 25 Left 1002710144 5:181190425-181190447 CCTGTGGGGCAGGCGTTTCGGGG No data
Right 1002710154 5:181190473-181190495 GCGCTAGTGCCCGAACGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002710154 Original CRISPR GCGCTAGTGCCCGAACGTGC TGG Intergenic