ID: 1002713310

View in Genome Browser
Species Human (GRCh38)
Location 5:181208466-181208488
Sequence CACGGTAGCCAAAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002713310_1002713315 26 Left 1002713310 5:181208466-181208488 CCTTCCTCCTTTTGGCTACCGTG No data
Right 1002713315 5:181208515-181208537 ACAGATATCTGTTTGAGTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002713310 Original CRISPR CACGGTAGCCAAAAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr