ID: 1002715751

View in Genome Browser
Species Human (GRCh38)
Location 5:181225868-181225890
Sequence CAGTGGGACCAGGAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 884
Summary {0: 1, 1: 0, 2: 5, 3: 103, 4: 775}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002715739_1002715751 23 Left 1002715739 5:181225822-181225844 CCAGCACAAATAGCACTACTTAG 0: 1
1: 0
2: 1
3: 5
4: 78
Right 1002715751 5:181225868-181225890 CAGTGGGACCAGGAGGAGGAGGG 0: 1
1: 0
2: 5
3: 103
4: 775
1002715744_1002715751 -6 Left 1002715744 5:181225851-181225873 CCTGGATGGGTTTGAAGCAGTGG 0: 1
1: 0
2: 2
3: 20
4: 170
Right 1002715751 5:181225868-181225890 CAGTGGGACCAGGAGGAGGAGGG 0: 1
1: 0
2: 5
3: 103
4: 775

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002715751 Original CRISPR CAGTGGGACCAGGAGGAGGA GGG Intronic
900166094 1:1244908-1244930 GAGGGGGAAGAGGAGGAGGAGGG - Intronic
900296913 1:1956502-1956524 CAGTGGGCCTGGGAGAAGGAGGG - Intronic
900466863 1:2830017-2830039 CAGGGGGACCAGGAAGACGCTGG - Intergenic
900474557 1:2869996-2870018 CAGAGGGAAGAGGAGGATGAAGG + Intergenic
900700803 1:4047556-4047578 GAGGGGGAGGAGGAGGAGGAAGG + Intergenic
901034361 1:6327385-6327407 CGGCAGGAGCAGGAGGAGGAGGG - Exonic
901054936 1:6444685-6444707 GAGTGTGCCCAGGAGGAAGACGG + Intronic
901105386 1:6751863-6751885 GAGTAGGAGGAGGAGGAGGAGGG - Intergenic
901536066 1:9883667-9883689 CAGGAGGACCATGAGGAGGGAGG - Intronic
901633078 1:10657300-10657322 CCCTGGGGCCTGGAGGAGGACGG - Intronic
901639914 1:10687967-10687989 TAGTGGGGGCAGAAGGAGGAAGG - Intronic
901679797 1:10906397-10906419 CAGTGGGCTCAGGGAGAGGAAGG - Intergenic
901817039 1:11800286-11800308 CAGTGGGAAGAGGAGGAGGGAGG - Exonic
901829794 1:11885480-11885502 CAGTGGGACCTGGGGTAGGGAGG + Intergenic
902456422 1:16536681-16536703 CAGTGGGACCAGCAGGAGCCTGG - Intergenic
902479419 1:16703918-16703940 GAGTGTGCCCAGGAGGAAGAGGG - Intergenic
902495741 1:16871230-16871252 CAGTGGGACCAGCAGGAGCCTGG + Intronic
902687699 1:18089592-18089614 CAGTGGGATCAGGACCAGGAAGG + Intergenic
902786076 1:18733577-18733599 CAGAGGGAAAAGGTGGAGGAGGG + Intronic
902839340 1:19065346-19065368 CAGGGTAACCGGGAGGAGGACGG + Intergenic
902847577 1:19123973-19123995 CACTGGCAGCAGGAGGAAGAAGG + Intronic
902907164 1:19566815-19566837 CAGGGGGACAAGGAGGAAGCTGG + Intergenic
902959753 1:19954845-19954867 CAATGGGTCAAGGAGGAGGAAGG - Intergenic
903515621 1:23909008-23909030 CAGTGGAAGCAGGTGGGGGAGGG + Intronic
903549920 1:24150691-24150713 CAGTAGGAGGAGGAGGAGGGCGG + Intergenic
903679794 1:25089229-25089251 GAGTGGGAGCAGGATGGGGAGGG + Intergenic
903686144 1:25133458-25133480 CATTGGGACCAAGAGGATGTTGG - Intergenic
904648494 1:31986718-31986740 GAGTGGGTGCAGGAGGTGGAGGG - Intergenic
905010277 1:34742379-34742401 CAGTGAGACAATGAGGTGGATGG - Intronic
905111135 1:35595403-35595425 CAGCTGGACCAGGAGGGAGAGGG + Intergenic
905244461 1:36602957-36602979 CAGTGGGATGAGGAGGTGAATGG + Intergenic
905253804 1:36666718-36666740 CCCTGGGCCCAGGAGAAGGAAGG + Intergenic
906135254 1:43495268-43495290 CACTGGGAACAGCAGGAGGGAGG + Intergenic
906205157 1:43982584-43982606 CAGAGGGACCTGGAGGATGCAGG + Intronic
906531048 1:46524250-46524272 CAGAGGCATCAAGAGGAGGAGGG - Intergenic
907328028 1:53653604-53653626 CAGTGGGGTGAGGGGGAGGAGGG - Intronic
907848800 1:58234553-58234575 AGGTGGGCCCAGCAGGAGGAGGG - Intronic
907970442 1:59375717-59375739 CACTGGGAATAGGAGGAGCAAGG - Intronic
908280604 1:62530883-62530905 CAGTGGGAGAAGGAGGAGCCAGG - Intronic
909253645 1:73390471-73390493 AAGTAGGACGAGGAGGAGGAAGG - Intergenic
909420072 1:75454054-75454076 CATTGGGATCAGGGTGAGGATGG - Intronic
909878633 1:80844701-80844723 CAGTGGGACCTGCTGGGGGAGGG - Intergenic
909931405 1:81503446-81503468 CAGAGGGACCAGCTGGTGGAGGG - Intronic
911275434 1:95853293-95853315 CAGTGGCACCTGGAAGGGGAGGG - Intergenic
912285589 1:108365157-108365179 GAGTGGGAGCAGAAAGAGGAAGG - Intergenic
912671246 1:111628300-111628322 CAGTGGCAGCAGGAGGGGAATGG + Intronic
912721657 1:112025409-112025431 CAGAGGGACCAGGTGTGGGATGG - Intergenic
912921966 1:113877148-113877170 CATAGGGAACAGTAGGAGGAGGG + Intergenic
913072330 1:115310900-115310922 GAGTGGGAGGAGGAGGAGGAAGG + Intronic
913148655 1:116017788-116017810 GAAGGGGACCAGGAAGAGGAAGG + Intronic
913162198 1:116154533-116154555 CTGTGGGACTATGAAGAGGAGGG - Intergenic
913661754 1:121010930-121010952 AAGTGGGACCAGCAGGAGCCTGG - Intergenic
913996444 1:143654664-143654686 GAGTGGGACCAGCAGGAGCCTGG - Intergenic
914013127 1:143794110-143794132 AAGTGGGACCAGCAGGAGCCTGG - Intergenic
914164699 1:145167075-145167097 AAGTGGGACCAGCAGGAGCCTGG + Intergenic
914239907 1:145846401-145846423 CAGTGGGGCCAGTAGGTGAATGG - Intronic
914376372 1:147077253-147077275 GAGTGGGACCAGCAGGAGCCGGG + Intergenic
914651751 1:149702719-149702741 AAGTGGGACCAGCAGGAGCCTGG - Exonic
915057636 1:153149981-153150003 CAGGTGGACAAGGAGGAGGCAGG + Exonic
915364184 1:155304960-155304982 CTGTGGGGCCAGGAGGCTGACGG + Intergenic
915572428 1:156751744-156751766 GAGTGGGTCCGGGAGGAGGGAGG - Intronic
915929215 1:160048378-160048400 CAGTTGGCCCAGAAGGAGCAGGG - Intronic
915969358 1:160343006-160343028 CAGACGGACCCGGAGGAAGACGG - Intronic
915980854 1:160419183-160419205 CAGTGGGGGCAGCAGCAGGAAGG - Exonic
916585133 1:166143639-166143661 ATGTGGAACCAGGAGGAAGAGGG + Intronic
916606021 1:166343156-166343178 CAGGGGGAGCAGGGGGAGCAGGG + Intergenic
916679933 1:167094726-167094748 CAGTGGAACTAGGACTAGGAAGG - Intronic
918002943 1:180514609-180514631 GGGGGGGACGAGGAGGAGGAGGG + Intergenic
918464317 1:184806245-184806267 CAGTGGGAGCAGGAAGAAGTTGG + Intronic
919518028 1:198551027-198551049 TAGTGGGAGAAGGAGGAGGAAGG + Intergenic
919678472 1:200409912-200409934 CGGTGGGTCCAGGAGGGAGAGGG - Intronic
920071136 1:203304196-203304218 CGGTGGGAACAGGAGCAGGATGG + Intergenic
920810802 1:209283767-209283789 AAGTGGGAGCTGGAGCAGGAAGG - Intergenic
920904047 1:210142755-210142777 CAGTGGGAAATGGGGGAGGAAGG - Intronic
920942715 1:210499205-210499227 CAGAGGGACATGGATGAGGATGG - Intronic
921060249 1:211578958-211578980 CAGCCGGAGCAGGAGCAGGAGGG + Intergenic
921361009 1:214331136-214331158 AAGAGGGAGCAGGAGAAGGATGG + Intronic
921569427 1:216760702-216760724 CAGAGGGATCAGAAGAAGGAGGG + Intronic
921618373 1:217298633-217298655 CAGTGGGCTGAGGTGGAGGACGG + Intergenic
922345965 1:224696592-224696614 AAGTGGGACCTGGAGGAGGCTGG + Intronic
922668229 1:227490665-227490687 CAGAGGGAAGAGGAGGAGGCAGG - Intergenic
923087016 1:230709804-230709826 CAGCAGGTCCAGGAGGTGGACGG + Intronic
923341284 1:233009033-233009055 CAGTGTGGCCAGTAGGAGCAAGG + Intronic
923545481 1:234920299-234920321 CAGTGGTGCCAGCTGGAGGAGGG - Intergenic
924646027 1:245878005-245878027 GAGTGTTCCCAGGAGGAGGAAGG + Intronic
924658870 1:245997962-245997984 CAGTGGGATCAGAAAGAGGTTGG - Intronic
924852601 1:247845322-247845344 CAGTGGATCCAGGAAGAGGGAGG - Intergenic
1062907268 10:1187374-1187396 CGATGGGAGCGGGAGGAGGAGGG - Intronic
1062907281 10:1187409-1187431 GGATGGGAGCAGGAGGAGGAGGG - Intronic
1063182645 10:3619113-3619135 CCCTGGAAACAGGAGGAGGAGGG + Intergenic
1063221723 10:3975183-3975205 CAGAGAGACCAGAAGAAGGAAGG + Intergenic
1063556430 10:7084062-7084084 TGGTGGGAACAGAAGGAGGAGGG + Intergenic
1063969569 10:11372122-11372144 CAGTGGTCCCAAGAGGAGGCCGG - Intergenic
1064322867 10:14321957-14321979 TGGTGGGAGCAGGAGGAAGAGGG - Intronic
1065302039 10:24331634-24331656 CAGAGGGCCAAGGAGGAGAAAGG + Intronic
1065683034 10:28256579-28256601 AAGTGGCACAGGGAGGAGGATGG + Intronic
1066074081 10:31855000-31855022 GAGGAGGAGCAGGAGGAGGATGG + Intronic
1066562606 10:36686891-36686913 AAGAGGGAAGAGGAGGAGGAAGG + Intergenic
1067456257 10:46421275-46421297 CACAGGGCCGAGGAGGAGGAGGG + Intergenic
1067511483 10:46898505-46898527 CAGTGGGATTAAGAAGAGGACGG + Intergenic
1067630942 10:47963364-47963386 CACAGGGCCGAGGAGGAGGAGGG - Intergenic
1067650763 10:48153359-48153381 CAGTGGGATTAAGAAGAGGACGG - Intergenic
1069313222 10:67065515-67065537 CTGTGGGCCCAGGAAGAAGATGG - Intronic
1069556007 10:69399080-69399102 AAGGGGGACCAGGAGGAGTGGGG - Intronic
1069907012 10:71737953-71737975 AAATGGGCCCAGGAGCAGGAGGG - Intronic
1070590567 10:77797743-77797765 CACAGGGACCAGGAGGCAGAAGG + Intronic
1070602255 10:77873976-77873998 CAGTGTGAGCTGGAGGAGGGCGG - Intronic
1070789416 10:79180584-79180606 CTGGGGGACTCGGAGGAGGAAGG - Intronic
1071730559 10:88244265-88244287 CTGAGGAACAAGGAGGAGGAGGG - Intergenic
1071877767 10:89861338-89861360 GAGAGGGAAGAGGAGGAGGAGGG - Intergenic
1071877793 10:89861436-89861458 GAGGGGGAAGAGGAGGAGGAGGG - Intergenic
1071877808 10:89861482-89861504 GAGGGGGAGGAGGAGGAGGAAGG - Intergenic
1072188201 10:93061504-93061526 CAGTGGGAGCCGGGGGAAGAAGG - Intronic
1072195498 10:93114444-93114466 CAATGGGAGAAAGAGGAGGAGGG - Intergenic
1072608348 10:97001420-97001442 CAGGAGGAAGAGGAGGAGGAGGG + Intronic
1072740669 10:97907236-97907258 CACGGGCAGCAGGAGGAGGAAGG + Intronic
1072911808 10:99508872-99508894 GAGTGGGAGAAGGAGGAGGATGG - Intergenic
1073060970 10:100733430-100733452 CAGAGGGGCCATGAAGAGGAAGG - Intergenic
1073066904 10:100766495-100766517 CTGTTGGAGCTGGAGGAGGATGG - Intronic
1073327496 10:102651101-102651123 GAGTGAGAGCAGGAAGAGGAAGG - Intronic
1073336514 10:102714289-102714311 CAGGAGGAGGAGGAGGAGGAGGG - Exonic
1073771059 10:106736408-106736430 CTGTGGGAACATGAAGAGGAAGG - Intronic
1073942919 10:108718562-108718584 CAGTTGGAGCAGGTGGAGGAGGG + Intergenic
1074077659 10:110143340-110143362 CAGTGTGCCCAGGTGGAGAAGGG - Intergenic
1074235015 10:111576434-111576456 CCATGGGACGAGAAGGAGGAGGG - Intergenic
1075032023 10:119030030-119030052 CAGGACGACGAGGAGGAGGAGGG - Exonic
1075717554 10:124565857-124565879 CAGTGGGGACAGGAGGGGGAAGG + Intronic
1075761663 10:124862215-124862237 CACTGGGAGCAGGAGCAGGGTGG + Intergenic
1076218068 10:128711560-128711582 CCGTGGGAGCAGGAAGAGCATGG - Intergenic
1076318900 10:129564261-129564283 GAGGGGGAAGAGGAGGAGGAAGG - Intronic
1076480573 10:130782662-130782684 CAGAGAGACCAGCAGGGGGAGGG + Intergenic
1076550990 10:131278080-131278102 CAGTGGGCCCGGGGGGAGGCAGG - Intronic
1076686219 10:132199602-132199624 CAGTGCGGACAGCAGGAGGAGGG - Intronic
1077015992 11:399409-399431 CAGAGGGGGCAGGTGGAGGAGGG - Intronic
1077016021 11:399482-399504 CAGAGGGGGCAGGTGGAGGAGGG - Intronic
1077177147 11:1196145-1196167 GGGGGGGACCTGGAGGAGGAGGG + Intronic
1077332535 11:1989779-1989801 TAGAGGGAAGAGGAGGAGGACGG + Intergenic
1077333771 11:1994502-1994524 CCAGGGGACCAGGAGGAGGGAGG - Intergenic
1077358047 11:2127682-2127704 CAGTGGGGACAGGAGCAGGAGGG + Intergenic
1078361798 11:10675012-10675034 CAGAGTGACCCGGAGCAGGAAGG + Intronic
1078528741 11:12120325-12120347 AGCTGGGAACAGGAGGAGGAGGG + Intronic
1080381569 11:31777266-31777288 CAGGGTCACAAGGAGGAGGATGG - Intronic
1080963373 11:37186221-37186243 GAATGGGACCGGGATGAGGAAGG - Intergenic
1081540546 11:44031571-44031593 GAGAGGGAGCAGGAGGAGGTGGG + Intergenic
1081569238 11:44279320-44279342 CAGTGGGAACTGCAGAAGGAAGG - Intronic
1081587753 11:44398856-44398878 CTGTGGGAACTGGAGCAGGATGG + Intergenic
1082073538 11:47958755-47958777 AAGTGGGACCAAGAGGAGGATGG - Intergenic
1083280001 11:61621009-61621031 CAGTGTGACCAAGAGGGGGAGGG - Intergenic
1083553728 11:63609644-63609666 CAGAGAGAGAAGGAGGAGGAGGG + Intronic
1083619546 11:64042101-64042123 CAGTGGGACCAGGCGGGAGGGGG + Intronic
1083884006 11:65562166-65562188 CTCCGGCACCAGGAGGAGGAGGG - Intergenic
1084196329 11:67525109-67525131 CAGAGGGACCCTGGGGAGGAGGG - Intergenic
1084196346 11:67525151-67525173 CAGAGGGACCCTGGGGAGGAGGG - Intergenic
1084196363 11:67525194-67525216 CAGAGGGACCCTGGGGAGGAGGG - Intergenic
1084425774 11:69083898-69083920 CAGTGGGGCCAGGAGGAGTAAGG + Intronic
1084605793 11:70170920-70170942 CAGTGGGGCCAGGGGGAAGGAGG - Exonic
1084978845 11:72817811-72817833 AAGTGGCAGGAGGAGGAGGAGGG + Exonic
1085260220 11:75200312-75200334 CAGGCTGACCAGGAGCAGGAAGG - Exonic
1085759978 11:79233445-79233467 CAGGGGGACGGGAAGGAGGAGGG + Intronic
1087277054 11:96171149-96171171 TGGTGGGACCAGAAAGAGGATGG + Intronic
1088588528 11:111380401-111380423 CACTGGGACCAGTGGTAGGAGGG - Intronic
1088691564 11:112333007-112333029 CTGGGGGAGCAGTAGGAGGAAGG - Intergenic
1088915865 11:114227286-114227308 CATGGGGCCCAGGAGGTGGATGG - Intronic
1089305601 11:117524467-117524489 CAGTGGGATGAGGAGGGTGATGG - Intronic
1089583524 11:119496047-119496069 CAGAGACTCCAGGAGGAGGAGGG - Intergenic
1089778441 11:120855998-120856020 CAGGGGGACCAGGAAAAGGAAGG + Intronic
1089905227 11:122031424-122031446 TAGTGGGAGGAGGAGGAGGAGGG + Intergenic
1090017317 11:123097749-123097771 CAGGAGGACAAGAAGGAGGAGGG + Intronic
1090104792 11:123841270-123841292 CAGTGAGGTCAGGAGGATGAGGG + Intergenic
1090326199 11:125888069-125888091 CCCTGGGACCAGGCGGAGGCCGG + Intronic
1090652487 11:128819561-128819583 CAGTGGGAGGGGGAGGAAGAGGG + Intergenic
1091156966 11:133383075-133383097 CAGGGTGACCAGGAGGATGTTGG - Intronic
1091217052 11:133908521-133908543 CAGTGGAGGCAGGAGGAGGAGGG - Intergenic
1202815516 11_KI270721v1_random:44955-44977 TAGAGGGAAGAGGAGGAGGACGG + Intergenic
1202816752 11_KI270721v1_random:49684-49706 CCAGGGGACCAGGAGGAGGGAGG - Intergenic
1091603089 12:1929800-1929822 GAGGGGGAGGAGGAGGAGGAAGG + Intergenic
1091603174 12:1930052-1930074 GAGGGGGAGAAGGAGGAGGAGGG + Intergenic
1092881591 12:12891470-12891492 CAGAGGGACAAGGAGGGGGAGGG - Exonic
1094166167 12:27446261-27446283 CAGAGGGAGCAGGAGGGGAAGGG + Intergenic
1095752778 12:45729627-45729649 GAGGGGGAGGAGGAGGAGGAGGG - Intergenic
1095804122 12:46299691-46299713 AAGTAGGGCCAGGAGGAGAATGG + Intergenic
1095981166 12:47975560-47975582 CAGGGGGACCTGGAGGACCAGGG + Exonic
1095985289 12:47995272-47995294 CAGGGGGACCAGGAGGACCACGG + Exonic
1096019334 12:48309312-48309334 CAGTGGGACAAGTATGATGAAGG + Intergenic
1096195916 12:49648782-49648804 CAGTGGGAGCAGGAACAAGAAGG - Intronic
1096865705 12:54561470-54561492 TACTGGGACCTGGAGGAGGAAGG + Intronic
1097384640 12:58934754-58934776 GAGTGGGAAGAGCAGGAGGAGGG - Intergenic
1097947328 12:65385198-65385220 TGGTGGGAGAAGGAGGAGGATGG + Intronic
1098079197 12:66766022-66766044 TAGTGAGTCCTGGAGGAGGATGG - Intronic
1098246072 12:68519326-68519348 CAGTGAGGCCTGAAGGAGGAAGG - Intergenic
1098519929 12:71423621-71423643 CAGTGTGAGCAAGAGGATGATGG - Intronic
1098876539 12:75871858-75871880 CAGTGGGAGTGGGAGGAGGGAGG - Intergenic
1098901820 12:76118838-76118860 AAGTGGGAGACGGAGGAGGAGGG - Intergenic
1098981383 12:76960514-76960536 CATTTGCACCAGGAGGAAGATGG + Intergenic
1099438071 12:82667216-82667238 GACTGGGACCTTGAGGAGGATGG + Intergenic
1099904321 12:88754021-88754043 CAGAGGCCACAGGAGGAGGATGG + Intergenic
1100793146 12:98152567-98152589 CAGAGGTACCAGGAGGAGACAGG + Intergenic
1101264814 12:103073161-103073183 CAGTGGGACCTATTGGAGGATGG + Intergenic
1101649181 12:106659310-106659332 TAAAGGGACCAGGAGCAGGAGGG - Intronic
1101869995 12:108558301-108558323 CTGTGGGATCAGGATGAGGTGGG + Intronic
1101870382 12:108560973-108560995 GCGTGGGATCAGCAGGAGGAAGG - Exonic
1102152759 12:110699957-110699979 CTCTTGGACCAGGAGGAAGAAGG - Intronic
1102455884 12:113070514-113070536 CTGAGGGACCAGCAGGAGGAAGG + Intronic
1102574288 12:113846224-113846246 CAGTGGGTACAAGAAGAGGAGGG + Intronic
1103990410 12:124795328-124795350 GACTGGGACCAGGGAGAGGAGGG - Intronic
1104536341 12:129621381-129621403 CAGTGGGGGCAGGGGGAGGGTGG - Intronic
1104707414 12:130957901-130957923 CAGTGAGAGGAGGACGAGGAAGG - Intronic
1104964749 12:132503895-132503917 CAGTGGGGGCAGGAGGCTGAGGG - Intronic
1104982213 12:132578447-132578469 GAGTGGGCTGAGGAGGAGGAGGG + Intronic
1105286868 13:19011736-19011758 CAGAAGGACCAGGAGCAGGCAGG + Intergenic
1106570039 13:30918583-30918605 CATTCTGAGCAGGAGGAGGAAGG - Intronic
1107589288 13:41884990-41885012 CAGTGAGACCCTGTGGAGGAGGG - Intronic
1108105871 13:47008459-47008481 CAGAGGGAGGAGGAGGAGGAGGG + Intergenic
1109258411 13:60112557-60112579 CAGAGGGGCCAGGAGGGGGTGGG - Intronic
1109743882 13:66594662-66594684 CACTGGGACCTGATGGAGGAGGG - Intronic
1110028710 13:70576676-70576698 TAGGGGGAGCAGGAGGAGGTGGG - Intergenic
1110428155 13:75392610-75392632 AAGTAGGACGAGGAGGAGGAGGG - Intronic
1112104091 13:96221515-96221537 CAGTGGGATGGGGAGGAGGTAGG + Intronic
1112383305 13:98914445-98914467 CATTTGAAACAGGAGGAGGAAGG + Intronic
1113081338 13:106523467-106523489 TAATTGGACAAGGAGGAGGAAGG + Intronic
1113403629 13:110018474-110018496 CATTGGAAGGAGGAGGAGGAGGG - Intergenic
1113487929 13:110668630-110668652 CTGTGGGACCAGGAGTGGGGAGG + Intronic
1113729023 13:112626404-112626426 CTGTGTGACTAGCAGGAGGAGGG - Intergenic
1113782822 13:112986484-112986506 CAGTGGGACCGTGGGGAGGTGGG - Intronic
1113788601 13:113015785-113015807 CAAGTGGCCCAGGAGGAGGAAGG + Intronic
1113955359 13:114097655-114097677 GACTGGGACGAGGAGAAGGACGG - Intronic
1114366662 14:22034294-22034316 CAGTGTGAACAGGAAGAGGCAGG + Intergenic
1114537160 14:23430275-23430297 CCGAGGGAGCAGGACGAGGAGGG - Intronic
1115023144 14:28707571-28707593 CAGTGGGACCAAAAGCAAGAAGG + Intergenic
1116804700 14:49481524-49481546 CAGATGGACCAGGTTGAGGAAGG - Intergenic
1117016959 14:51527892-51527914 CAGTGGGGCCAGGCTGAGGTGGG + Intronic
1117442698 14:55774838-55774860 CAGTGGGGAGAGGATGAGGAGGG - Intergenic
1117533079 14:56677532-56677554 CAGTCTGTCCAGGAGGAGAAAGG - Intronic
1117536721 14:56709641-56709663 GAGTGGGACCACAAGAAGGAAGG + Intronic
1118186422 14:63542718-63542740 CAGGAGGACCGGGAGGAAGAAGG + Intronic
1118744145 14:68761884-68761906 TTGTGGGACCCTGAGGAGGAAGG - Intergenic
1118894766 14:69936536-69936558 CAGTGGGAGGGGAAGGAGGAAGG - Intronic
1119012604 14:71010966-71010988 CAATGGAAACAGTAGGAGGAGGG + Intronic
1119057528 14:71438375-71438397 GAGTGGGAACAAGAGCAGGAAGG - Intronic
1119180384 14:72601044-72601066 AAGGGGGAAGAGGAGGAGGAGGG + Intergenic
1119421877 14:74512068-74512090 GAGTGGCAACAGGAAGAGGAGGG + Intronic
1119658212 14:76432456-76432478 CAGGAGGACTAGGAGAAGGAGGG - Intronic
1120911680 14:89672624-89672646 CAGTGGGACATGGGGCAGGAGGG - Intergenic
1120963962 14:90151011-90151033 AAGTGTGAACAGGAGGAAGAAGG - Intronic
1121209858 14:92200063-92200085 CAATGGGACCCATAGGAGGAGGG + Intergenic
1121664193 14:95659338-95659360 AAGTGGGACCCAGAGCAGGAGGG + Intergenic
1122015336 14:98790269-98790291 CAGTGGGACCAGGTGGGAGCAGG - Intergenic
1122079218 14:99255436-99255458 CAGGGGGGCCAGGGGGTGGAAGG + Intronic
1122082427 14:99274745-99274767 GAGGGGGAGAAGGAGGAGGAGGG - Intergenic
1122143520 14:99675920-99675942 CTGTGGGACCCTGAGGAGGGAGG + Exonic
1122168752 14:99853343-99853365 CAGTGGAAACAGGGGCAGGAGGG + Intronic
1122412135 14:101531040-101531062 CAGAGGGACCAGGGGCAGGGCGG - Intergenic
1122652398 14:103232709-103232731 CAGTGGGAGCAGCAGGGGGATGG + Intergenic
1122782624 14:104150110-104150132 GAGGGGGACCAGGAGGGGGAGGG - Intronic
1123842199 15:24260388-24260410 CAGTGGGTCCAGGAGACGGGAGG + Intergenic
1123989495 15:25673010-25673032 GGGTGGGACGAGGAGAAGGAGGG + Intergenic
1124047253 15:26161710-26161732 CAGCAGTACCAGCAGGAGGAAGG - Intergenic
1124142046 15:27086224-27086246 CCCTAGGAGCAGGAGGAGGAAGG + Intronic
1125895482 15:43298322-43298344 CAGCAGGGCCAGGATGAGGAGGG + Intronic
1126679985 15:51193109-51193131 CAGTGGGGCTTGGGGGAGGACGG + Intergenic
1126697668 15:51340026-51340048 TGGTGGGAGCAGGAGGAAGAGGG + Intergenic
1126855464 15:52834660-52834682 AAGTGGGTGGAGGAGGAGGAGGG + Intergenic
1126860698 15:52879958-52879980 AAGAGGGACCAGCAGGAGGATGG - Intergenic
1127635950 15:60869822-60869844 CAGAGGGAACAAGAGGAGGATGG - Intronic
1128470537 15:67948236-67948258 CACTGGGGCCTGTAGGAGGATGG - Intergenic
1128869821 15:71145864-71145886 GAGGAGGAGCAGGAGGAGGAGGG + Intronic
1129295069 15:74595751-74595773 CAGAGGGACCAGCTGGTGGAGGG - Exonic
1129533105 15:76285411-76285433 CACTGGCACCAGGGGGAGCATGG - Intronic
1129828262 15:78650034-78650056 GAGTGTGCCCAGGAGGAGGATGG + Intronic
1131423363 15:92326034-92326056 CAGTGGTACCTGGAGAAGGGAGG + Intergenic
1131514479 15:93067930-93067952 AGGCAGGACCAGGAGGAGGAAGG + Intronic
1131540335 15:93270146-93270168 CAGGGAGATGAGGAGGAGGAGGG + Intergenic
1131601874 15:93857580-93857602 CAGTGGCACCAGGACCAGGTTGG - Intergenic
1131721616 15:95174681-95174703 CAATGTGACCTGGAGGAGAAGGG - Intergenic
1131983387 15:98017408-98017430 CAGAGGGAGCAGGGGGAGGATGG - Intergenic
1132024469 15:98393047-98393069 GAGAGGGAACAGGAGCAGGAAGG + Intergenic
1132116012 15:99137053-99137075 CTGTGGGACCAGGGGAGGGAGGG + Exonic
1132656608 16:1044241-1044263 CAGGGGTCCCAGGAGGAGGGCGG - Intergenic
1132712118 16:1273578-1273600 CGGAGGGGCCAGGACGAGGAAGG + Intergenic
1132812670 16:1809021-1809043 CAGTGGCTCACGGAGGAGGAAGG + Exonic
1132885841 16:2181624-2181646 CAGGTGGACCAGGAGGCGGAGGG + Intronic
1133624989 16:7562729-7562751 CAGTGGGGGAAGGAGGAGGAAGG + Intronic
1133850167 16:9495982-9496004 AAGAGGGAGGAGGAGGAGGAGGG - Intergenic
1133888109 16:9850923-9850945 GTGTGGGAGCAGGAGGAGAAGGG - Intronic
1133929135 16:10217996-10218018 CAGTGGGAGCAGGAGGCTGGTGG + Intergenic
1133994739 16:10739911-10739933 TTGCAGGACCAGGAGGAGGAGGG + Intergenic
1134085570 16:11355213-11355235 CAGGTGAAGCAGGAGGAGGAAGG + Intergenic
1134273243 16:12753572-12753594 TAGTCAGACCTGGAGGAGGAGGG - Intronic
1134509293 16:14833758-14833780 CAGCCGGCCTAGGAGGAGGAAGG + Exonic
1134696998 16:16232573-16232595 CAGCCGGCCTAGGAGGAGGAAGG + Exonic
1134974844 16:18562112-18562134 CAGCCGGCCTAGGAGGAGGAAGG - Intronic
1135597407 16:23754946-23754968 CAGTGGCCCCAGGGGGACGAAGG - Exonic
1136020968 16:27439828-27439850 CCCAGGGCCCAGGAGGAGGAAGG - Intronic
1136080987 16:27852530-27852552 CAGAGGGAGGAGGAGGAGGGTGG + Intronic
1136398820 16:30006929-30006951 CAGTTGGAGCAGGCGGAGCAGGG - Exonic
1138173327 16:54873556-54873578 CAGTGGGATCACGAAGGGGAAGG - Intergenic
1138199358 16:55077614-55077636 AAATGGGACAAGGAGGATGAAGG + Intergenic
1138590259 16:57995859-57995881 CAGTGGGCCCAGGGGGAAGGGGG - Exonic
1138594083 16:58020256-58020278 CAGAGGGCCCTGGAGGAGGAAGG - Exonic
1139496968 16:67326872-67326894 CAATGGGAGCTGGACGAGGAAGG + Exonic
1139546200 16:67650846-67650868 AGGAGGGACCAGGAGGAGCAAGG - Intronic
1139946263 16:70644690-70644712 CAGGGTGAGGAGGAGGAGGAGGG + Intronic
1140270889 16:73465455-73465477 CAGAGGCACCAGGAGGAGACGGG - Intergenic
1140417624 16:74787412-74787434 GAGTGGGAACAGGGGGAAGAAGG - Intergenic
1140655197 16:77132485-77132507 GAGGAGGACGAGGAGGAGGAGGG - Intergenic
1140854709 16:78967881-78967903 CAGTAGCTGCAGGAGGAGGAGGG + Intronic
1141491362 16:84376076-84376098 CAGTGGGAGAAAGAGGTGGATGG + Intronic
1141631640 16:85291286-85291308 CCTTGGGACAGGGAGGAGGAGGG - Intergenic
1141703628 16:85653308-85653330 AAGTGGGAGGAGGAGGAGGAGGG - Intronic
1141714019 16:85716650-85716672 CAGAGGGAGAAGGAGGAGGAAGG + Intronic
1141764862 16:86051644-86051666 CAGCCAGCCCAGGAGGAGGAAGG - Intergenic
1141775786 16:86121840-86121862 CGGCGGGACAAGCAGGAGGAGGG - Intergenic
1141891803 16:86930998-86931020 GAGTGGGATGAAGAGGAGGAGGG - Intergenic
1141897294 16:86966230-86966252 CAGTGGAAGCTGGAGGAGGAAGG - Intergenic
1141974694 16:87507772-87507794 AAGTGTGACCAGGAGGAGGCTGG + Intergenic
1142007013 16:87694145-87694167 GAACTGGACCAGGAGGAGGAGGG + Intronic
1142256296 16:89015331-89015353 CAGAAGGACCAGGAGGGGGACGG + Intergenic
1142256312 16:89015383-89015405 CAGGAGGACGAGGAGGGGGATGG + Intergenic
1142707864 17:1708022-1708044 CAGCGGGACCAGGCGGAAGAGGG + Exonic
1142849128 17:2695855-2695877 CTGCGGGAGGAGGAGGAGGATGG + Intronic
1142991571 17:3734697-3734719 TGGTTGGACCAGGAGGAGGCTGG + Intronic
1143036779 17:4004074-4004096 CTGCGGAACCCGGAGGAGGAAGG - Intergenic
1143049202 17:4109411-4109433 CTGTGTGACGAGGAGCAGGAAGG + Intronic
1143508685 17:7383695-7383717 CACTGGGACCTGGAGGTGGGGGG - Exonic
1143543317 17:7582260-7582282 CAGTGGCCCCAAGAGGAGGAAGG - Intergenic
1144137756 17:12314618-12314640 CAGTGGCAGCAGCAGGAGGGTGG + Intergenic
1144209726 17:13003901-13003923 GAGAGGGAGCAGGAGGAGGCAGG - Intronic
1144942719 17:18952607-18952629 GACTGGGACCAGGAGGCTGATGG - Intronic
1145351462 17:22088489-22088511 CTCTGGCACCAGCAGGAGGAGGG + Intergenic
1145771652 17:27497525-27497547 GAGTGGGACCAGGAGGAAACAGG + Intronic
1145990382 17:29075761-29075783 CAGTGGAGGCAGGAGGAGTACGG - Exonic
1146364516 17:32210688-32210710 CTGAGGGAGGAGGAGGAGGAGGG + Intronic
1146460328 17:33041109-33041131 CTGTGTGGGCAGGAGGAGGAGGG - Intronic
1146812999 17:35918400-35918422 CAGTATGGCCAAGAGGAGGAAGG - Exonic
1146941237 17:36845821-36845843 TAGAGAGACCAGGAGAAGGAGGG - Intergenic
1147169469 17:38609537-38609559 GAGTGGGAGGAGGAGCAGGAGGG - Intergenic
1147443388 17:40460916-40460938 CAAGGGGACCAAGAGAAGGAGGG - Intergenic
1147498777 17:40942374-40942396 GAGGGGGAGGAGGAGGAGGAGGG - Intergenic
1147794058 17:43030218-43030240 CAGTGGGACCAGAGCCAGGAAGG - Intergenic
1148208569 17:45794641-45794663 GAGTGTGACAAGGAGGGGGAAGG - Intronic
1148457598 17:47819426-47819448 GAATGGGACCAGGATGAGGGTGG + Intronic
1148512142 17:48180312-48180334 AAGAGGGAGAAGGAGGAGGAGGG + Intronic
1148647011 17:49225024-49225046 CAGCAGGAGGAGGAGGAGGAGGG + Exonic
1149291870 17:55225421-55225443 CAGAGGGCACAGGAGGAGCAGGG - Intergenic
1149418545 17:56485879-56485901 CAGTAGGTCCAGCAGGAGGCTGG + Intronic
1149540296 17:57463441-57463463 CAGTGGGGCCATGGGGAGGGAGG - Intronic
1149581395 17:57752834-57752856 CAGTGAGAATAGGAGCAGGATGG + Intergenic
1149596473 17:57867462-57867484 CAGTGGGACTGGGAGGACTAGGG - Intronic
1150124944 17:62629423-62629445 CACAGAGACCAGGAGGAGGAGGG - Intronic
1150222800 17:63506745-63506767 CAGTTGGACCAGGAGGTGGATGG + Intronic
1151459840 17:74248083-74248105 CAGTGGCTCCTGAAGGAGGACGG + Intronic
1151658263 17:75505752-75505774 AAGTGGTACCAGGATGTGGAGGG - Intronic
1152000435 17:77641917-77641939 CAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1152087080 17:78226880-78226902 CAGCGGGACCAGGAAGGGAAGGG + Intergenic
1152204886 17:78969332-78969354 CAATGAGATCAGGAGGAAGAAGG - Intergenic
1152324019 17:79625144-79625166 GAGAGGGAGGAGGAGGAGGAGGG - Intergenic
1152334139 17:79690721-79690743 CAGTGGGATGACGAGGAGGATGG + Intergenic
1152336879 17:79703703-79703725 GAGAGGGGTCAGGAGGAGGAAGG + Intergenic
1152557335 17:81059968-81059990 CATGGGCACAAGGAGGAGGAGGG + Intronic
1152933491 17:83122515-83122537 CAGGGGAACCAGGTGGAGGGCGG + Intergenic
1153448157 18:5196806-5196828 CAGCGGGACGAGGGCGAGGAAGG + Intronic
1153761306 18:8334879-8334901 AAGTGGGAACAGGAGGAGCAAGG - Intronic
1154270301 18:12912483-12912505 CAGTGGGGCCAGGAGGGGAGGGG - Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156398632 18:36721011-36721033 CAGTGGGACCAAGAGAAGGAGGG - Intronic
1156791755 18:40984096-40984118 CAGGGGGAGGAGGAGGAAGAGGG - Intergenic
1157386243 18:47261562-47261584 AAGTAGGACCAGGGGCAGGAGGG + Intergenic
1157913888 18:51645488-51645510 CAGTGGGTCCAGAAGCAGCATGG + Intergenic
1158423136 18:57313545-57313567 CAGAAGGAAGAGGAGGAGGAAGG + Intergenic
1158471303 18:57739364-57739386 CAGTGGTAGCAGGAAGAGGAGGG - Intronic
1158505608 18:58044197-58044219 CGGTGGGAGGAGGCGGAGGAGGG + Intergenic
1159074809 18:63668286-63668308 CACAGGGACCAGTAGGGGGATGG - Intronic
1159877366 18:73827543-73827565 GGGTGGGAGCAAGAGGAGGAGGG + Intergenic
1159955499 18:74515851-74515873 CAGAGGCACCAGGAGTAAGAGGG - Intronic
1160209102 18:76861327-76861349 CAGTGAGAACGGGAGGAGGAAGG + Intronic
1160531419 18:79567177-79567199 CAGAGGGACGAGGATGAGGCCGG - Intergenic
1160623526 18:80187609-80187631 CAGGGGAGCCAGGAGGTGGATGG - Intronic
1160672812 19:374214-374236 CAGTGGGGACAGGAGGAGCCCGG + Intronic
1160752676 19:741781-741803 CAGGGACCCCAGGAGGAGGAGGG + Intronic
1160819718 19:1052362-1052384 GAGGGGGAAGAGGAGGAGGAGGG + Intronic
1161085440 19:2332963-2332985 GAGGGGGAGCAGGAGGAGGGTGG + Intronic
1161085461 19:2333024-2333046 GAGGGGGAGCAGGAGGAGGGTGG + Intronic
1161085499 19:2333145-2333167 GAGGGGGAGCAGGAGGAGGGTGG + Intronic
1161370632 19:3908929-3908951 GAGCGGGAAGAGGAGGAGGAAGG - Intronic
1161506781 19:4648445-4648467 CAATGGGTCAGGGAGGAGGAAGG + Intronic
1161567109 19:5009412-5009434 CAGTGGGGCCTGGAAGTGGAAGG + Intronic
1161588387 19:5117711-5117733 CACAGGGAGCAGGAGGTGGATGG - Intronic
1161640452 19:5419314-5419336 CAGAGGGACGAGGAATAGGATGG + Intergenic
1161837037 19:6654802-6654824 CAGGAGGAGGAGGAGGAGGATGG - Intergenic
1161854960 19:6759022-6759044 CTGTGTGACCAGCATGAGGAGGG + Intronic
1162500788 19:11052473-11052495 CAGTATGGCCAGGTGGAGGAAGG - Intronic
1162805495 19:13136048-13136070 GAGGAGGACGAGGAGGAGGATGG + Exonic
1162906483 19:13826907-13826929 CCATGGGACCTGGAGGAGGGTGG + Intronic
1162966094 19:14156814-14156836 CTCTGGGATCAGGAGGAGGAAGG + Intronic
1163023193 19:14494921-14494943 CAGTGTGGCCAGCAGGAGGAGGG + Intronic
1163111907 19:15166439-15166461 CAGTGGGTGCAGGAGTATGAAGG - Intronic
1163123834 19:15233456-15233478 CTGTTGGGCCAGCAGGAGGACGG - Intergenic
1163197419 19:15732807-15732829 GAGGTGGACCAAGAGGAGGAGGG + Intergenic
1163584514 19:18156539-18156561 CAGGAGGACCAGAGGGAGGAAGG + Intronic
1163643252 19:18473807-18473829 CAGTGGGGCCAGGTGGTGCAGGG - Intronic
1163801443 19:19368155-19368177 CAGTGGGGGCAGAAGGATGATGG - Intergenic
1164235003 19:23324039-23324061 GAGATGGACAAGGAGGAGGAGGG - Intronic
1164520190 19:28973187-28973209 CAGTGACACCAGAGGGAGGAGGG + Intergenic
1164827767 19:31297015-31297037 CAGTGGGAGCGGGAGGTGGGAGG + Intronic
1164868676 19:31625758-31625780 GAGAGGGAAGAGGAGGAGGAGGG - Intergenic
1165269714 19:34695562-34695584 GAGTGGGACCAAGAGCAGGGAGG - Intergenic
1165355028 19:35299370-35299392 CGGGGTGACCAAGAGGAGGAAGG + Intronic
1165416039 19:35694111-35694133 AAGAGGGAGGAGGAGGAGGAAGG - Intergenic
1165467369 19:35982891-35982913 CAGCAGGTACAGGAGGAGGAAGG - Intergenic
1165864074 19:38925407-38925429 AAGTGGGCCCAGGTGGAGGATGG + Intronic
1166338040 19:42121053-42121075 CAGTGGGACCAAGGGAATGAAGG - Intronic
1166373804 19:42316146-42316168 CCCTGGGTCCTGGAGGAGGAGGG + Intronic
1166859954 19:45804367-45804389 GAGGGCGACGAGGAGGAGGAAGG - Exonic
1167246015 19:48373668-48373690 CTGTGTGTCCAGGACGAGGAAGG - Exonic
1167445558 19:49535096-49535118 CTGGGGGCCCAGGAGGGGGAGGG - Intronic
1167507463 19:49878339-49878361 CAGTGGGACCTGAAGAAGGCTGG + Intronic
1167722818 19:51190564-51190586 CAGTGGGGCCAGGTTGAGGCGGG - Intergenic
1167761494 19:51452668-51452690 CAGTGGGGCCAGGATGAGGCAGG + Intronic
1168152517 19:54456522-54456544 CCATGGGAGAAGGAGGAGGAGGG + Intronic
1168178136 19:54640428-54640450 CACTGGGACCTGTTGGAGGAGGG - Intronic
1202713458 1_KI270714v1_random:29824-29846 GAGTGTGCCCAGGAGGAAGAGGG - Intergenic
924985266 2:264485-264507 GAGGGGTACCTGGAGGAGGAAGG - Intronic
925132452 2:1503469-1503491 CAGGGGGAGCAGGAGCAGGAGGG + Intronic
925177662 2:1796704-1796726 CAGCAGGAGCAGAAGGAGGATGG - Intronic
926248331 2:11137785-11137807 CAGTGGGAGCAGGAGGATATGGG + Intronic
926259544 2:11245754-11245776 CAGTGGGATCAGAATGAGGTTGG - Intronic
926805285 2:16704816-16704838 CTGTTGGACAAGGAGCAGGATGG - Intergenic
926874468 2:17459258-17459280 CGGTGGGAAGAGGAAGAGGAAGG + Intergenic
927391461 2:22600133-22600155 CTGTGGAACTAGGAGGTGGAGGG + Intergenic
927612661 2:24557491-24557513 GAGGAGGAGCAGGAGGAGGAGGG - Intronic
927758176 2:25725483-25725505 CAGTGGTCTCAGGAGGAGGAAGG - Intergenic
928013091 2:27629040-27629062 GGGTGGGGCCAGGAGGAAGATGG + Exonic
928437038 2:31261429-31261451 AAGTAGGAGCAGGAGGAGGCGGG + Intronic
929598916 2:43192956-43192978 CTGTGGGAGCAGGTGGAGGCTGG - Intergenic
929671258 2:43877736-43877758 CAGTGGGCTCATGAGGAGGATGG - Intronic
929732965 2:44515299-44515321 CAGTGGGACTGGGAGGAGTTAGG + Intronic
929778265 2:44941960-44941982 AGGGGGGAGCAGGAGGAGGAGGG - Exonic
929828943 2:45332073-45332095 CTGTAACACCAGGAGGAGGAAGG + Intergenic
930000740 2:46859983-46860005 CAGTGACCCCAGAAGGAGGAAGG + Intergenic
930911845 2:56638316-56638338 CATTGAGACCAGGAGGAAGAAGG + Intergenic
931812012 2:65863269-65863291 CAGTGGGACCGGGAGCATCATGG - Intergenic
932298616 2:70646945-70646967 CATTGGGAACAGGAGGATAATGG + Intronic
932593723 2:73081563-73081585 CAGTGGGAGCAGGAGTGGGAGGG + Intronic
932796709 2:74701968-74701990 CAGTGGGACCCCGATGAGAAGGG + Intergenic
932818202 2:74878517-74878539 CAGGGGCAGGAGGAGGAGGAAGG - Intronic
934034696 2:88079223-88079245 CACTGTGACCAGGAGAAGGCTGG - Intronic
934517617 2:94998625-94998647 CAGAGGGCCCTGGAGAAGGAGGG - Intergenic
935217856 2:100988812-100988834 CAGGGGGACCTGGAGGAGCAGGG - Intronic
935217910 2:100988960-100988982 CAGGGGGGCCTGGAGGAGCAGGG - Intronic
935296671 2:101655988-101656010 AAGTGGGGCCAGGGGGAGGGGGG - Intergenic
935632693 2:105224860-105224882 CAGCAGCACGAGGAGGAGGAGGG - Intergenic
936081111 2:109432905-109432927 GAATGGGATCAGGAGGAGCAGGG + Intronic
936444824 2:112587148-112587170 CATGGGGCCCAGGAGAAGGATGG - Intronic
937152324 2:119694583-119694605 CAAAGGGGCCAGGAGGAGGATGG - Intergenic
937985949 2:127638181-127638203 CAGTGGGCAGAGGAGGAGGTGGG - Intergenic
938260397 2:129891752-129891774 CAGCAGCAGCAGGAGGAGGATGG - Intergenic
938343796 2:130552358-130552380 CAGGAGGCCCAGGTGGAGGAGGG - Intergenic
938346037 2:130568364-130568386 CAGGAGGCCCAGGTGGAGGAGGG + Intergenic
938393878 2:130927299-130927321 CACTGACACCAGGAAGAGGATGG + Intronic
938488288 2:131738983-131739005 AAGTGGGCCCAGGAGAAGAATGG + Intronic
938973735 2:136456247-136456269 CAGTGGGGCCAGGAGGGTGGCGG - Intergenic
939045475 2:137245056-137245078 GAGGGAGACGAGGAGGAGGAGGG - Intronic
939160098 2:138577271-138577293 CAGGAGGAGGAGGAGGAGGAGGG + Intergenic
939983219 2:148805651-148805673 GAGGGGGAGGAGGAGGAGGAGGG - Intergenic
940016446 2:149111144-149111166 CAGAGGGACCCCCAGGAGGATGG + Intronic
940279360 2:151973613-151973635 TAGTGGGAGGAGGAAGAGGAGGG + Intronic
940990512 2:160091887-160091909 CAGTGGGAAAATAAGGAGGAAGG - Intergenic
942068783 2:172296550-172296572 CAGTAGGTCCAGGAGGAGGTGGG - Intergenic
942299380 2:174547335-174547357 AAGAGGGAGGAGGAGGAGGAGGG - Intergenic
942430904 2:175910417-175910439 TAGATGGACCAGGAGGAGGAGGG - Intergenic
942570399 2:177308480-177308502 CATTGGGAGTAGGATGAGGATGG - Intronic
942999754 2:182311511-182311533 CTGTAGGACCAGAAGTAGGAAGG - Intronic
943512711 2:188845777-188845799 GATTGGGAGCAGGAGGAGGTTGG + Intergenic
943890257 2:193277272-193277294 GAGGGGGAGGAGGAGGAGGAAGG - Intergenic
944537434 2:200725086-200725108 CAGAGGGTCCAGCAGGAAGAGGG + Intergenic
944539591 2:200743059-200743081 CTGGGGCACCAGGATGAGGATGG + Intergenic
945303415 2:208235485-208235507 CAGTGGCACCAGGAAGAGAACGG - Intergenic
945522614 2:210847226-210847248 CAGTGGGATGAGGAGGAGGCTGG - Intergenic
946324918 2:218980410-218980432 AAGTGAGAGCAGGACGAGGAGGG + Intergenic
946688512 2:222294300-222294322 CACTGGGGGCGGGAGGAGGAAGG + Exonic
947120327 2:226807633-226807655 CAGTGGGAGCAGAGTGAGGAAGG + Intergenic
947243108 2:228017832-228017854 CAGTGAGATCAAGAGGAAGACGG - Exonic
947243476 2:228020961-228020983 CAGTGGGTACAGAAGGAGAAGGG + Intronic
947372761 2:229465415-229465437 CAATGGGACCAGGGGGCTGAGGG + Intronic
947619507 2:231580593-231580615 AAGAGGGAGGAGGAGGAGGAGGG + Intergenic
947731374 2:232433374-232433396 CAGTGTGCCCAGGAGGAGAGGGG + Intergenic
948516098 2:238504734-238504756 CGGTGGGATCCGGAGGGGGAAGG + Intergenic
948658570 2:239492230-239492252 CACTGGGAGCAGGAAGAGGCAGG - Intergenic
948673633 2:239584420-239584442 CAGCGGGGCCAGGAGAAGGCTGG + Exonic
948730797 2:239962575-239962597 AAGTGGGACCTGGAAGTGGAGGG + Intronic
948818124 2:240523901-240523923 CAAAGGGACCATGCGGAGGATGG - Exonic
949004603 2:241637896-241637918 CGGTGGGAGCGGGAGGGGGACGG + Intronic
949043716 2:241860767-241860789 CAGTGGGACTGAGAGGAGGAGGG - Intergenic
1168804661 20:665464-665486 AAGTGGGAGGAGGAGGGGGAGGG - Intronic
1169235164 20:3924803-3924825 CTGTGGTACAAGCAGGAGGATGG - Intronic
1170162554 20:13328790-13328812 CACTGGGACCTGTAGGAGGGTGG + Intergenic
1170986597 20:21265035-21265057 CACTGGGACCAGCAAGGGGAGGG + Intergenic
1171128744 20:22628362-22628384 CAGTGGGACAAGGAGCAAGCAGG - Intergenic
1171948054 20:31396152-31396174 TAGTGGGATCAAGTGGAGGATGG - Intergenic
1171960866 20:31493124-31493146 CAGTGGGACTGGGAAGAGGATGG - Intergenic
1172115371 20:32570507-32570529 CTGTGGGGACAGGAGGGGGAAGG - Intronic
1172318924 20:33980924-33980946 CACTGGTTCCAGGAAGAGGATGG - Intergenic
1172629378 20:36367754-36367776 AAGTGGGAGCTGGAGGAGCATGG - Intronic
1172699269 20:36843018-36843040 CAGTGGCAGCATGAGGAGGGAGG - Intronic
1172835437 20:37870216-37870238 CAGTGAGACCAGGAAGAGAAAGG - Intronic
1173228644 20:41177116-41177138 CAGTGGTACCAGAAGGTAGATGG + Intronic
1173443308 20:43096512-43096534 CAGGAGCCCCAGGAGGAGGAGGG - Intronic
1173547996 20:43914340-43914362 CAGTGAGACGAGGAGGGGGCGGG + Intergenic
1173617660 20:44413596-44413618 GAGTGGGAGCAGGAGGTGGGGGG - Intronic
1173690000 20:44953267-44953289 CAGTGGGATCAGGAGCCAGAGGG - Intronic
1173825072 20:46043079-46043101 CTCTGGGACCAGGAGGTGGGAGG - Intronic
1174377948 20:50138835-50138857 CACTGGGACAAGGAGAGGGATGG + Intronic
1174576468 20:51541443-51541465 TAGAGGGAGGAGGAGGAGGAGGG - Intronic
1174592736 20:51658981-51659003 CAGAGGGAACGGGAGGAAGATGG - Intronic
1174749433 20:53097141-53097163 CCCTGGGACAAGGAGGGGGATGG + Intronic
1175295316 20:57904287-57904309 GAGTAGGCTCAGGAGGAGGAGGG - Intergenic
1175366425 20:58459511-58459533 GATAGGGATCAGGAGGAGGAAGG + Exonic
1175399074 20:58689778-58689800 GTGTGTGGCCAGGAGGAGGAAGG - Intronic
1175531123 20:59674754-59674776 GAGGGGGAACAGGAGAAGGAGGG - Intronic
1175771627 20:61627926-61627948 CAGGGGGCCCAGGAGGCGGCTGG - Intronic
1175968782 20:62673463-62673485 CAGTGACACCCGGAGGAGGCAGG - Intronic
1176219453 20:63963159-63963181 CAGTGGGTGCAGGGGAAGGAGGG + Exonic
1176296640 21:5076660-5076682 GTGAGTGACCAGGAGGAGGAGGG + Intergenic
1177004044 21:15648725-15648747 CAGTGAGAAAAGGAGGAAGAGGG - Intergenic
1177282140 21:18994472-18994494 AAGGGGGAGGAGGAGGAGGAAGG + Intergenic
1177690511 21:24500254-24500276 CACTTGACCCAGGAGGAGGAGGG + Intergenic
1177758261 21:25373584-25373606 GAGGGGGAGGAGGAGGAGGAGGG - Intergenic
1177758288 21:25373643-25373665 GAGTGGGAGGAGGAGGAGGAGGG - Intergenic
1178538728 21:33431652-33431674 CACTTGGACCAGGAGGCAGAGGG - Intronic
1178887179 21:36493598-36493620 CTGGGGCACGAGGAGGAGGAGGG + Intronic
1178982124 21:37273518-37273540 AAGAGGGAGAAGGAGGAGGAGGG + Intergenic
1179001713 21:37467310-37467332 ACCTGGGCCCAGGAGGAGGAGGG - Intronic
1179860409 21:44185461-44185483 GTGAGTGACCAGGAGGAGGAGGG - Intergenic
1180065580 21:45410487-45410509 CAGTGGGAACGGCAGGAGGAGGG + Intronic
1180228858 21:46414418-46414440 CAGGAGGAGGAGGAGGAGGAGGG - Intronic
1180228870 21:46414455-46414477 CTGTGTGTCCAGGAGGAGGAGGG - Intronic
1180228898 21:46414566-46414588 CTGCGTGTCCAGGAGGAGGAGGG - Intronic
1180228941 21:46414734-46414756 CTGCGTGTCCAGGAGGAGGAGGG - Intronic
1180228949 21:46414761-46414783 CTGTGTGTCCAGGAGGAGGGTGG - Intronic
1180228973 21:46414857-46414879 CTGTGTGTCCAGCAGGAGGAGGG - Intronic
1180781684 22:18523791-18523813 TGGTAGGACAAGGAGGAGGATGG - Intergenic
1181236031 22:21448172-21448194 CAGGGGAACCATGAGGAGGGTGG + Exonic
1181238568 22:21463134-21463156 TGGTAGGACAAGGAGGAGGATGG - Intergenic
1181318816 22:21989096-21989118 AAGTGGGTGCAGCAGGAGGAAGG + Intergenic
1181462795 22:23095264-23095286 CAGTGGGAGCCGGAGGCGGGGGG + Exonic
1181494309 22:23279406-23279428 CAGTGGGACCAGGAGCAAGGAGG - Intronic
1181546516 22:23605515-23605537 TAGTGGGAGGAGGAGGAGGAGGG + Intergenic
1181562703 22:23714984-23715006 CAGTGAGGCCAGGAGCAGGCAGG - Intergenic
1182143803 22:27984461-27984483 CAGAGTGACAAGGATGAGGAGGG - Intronic
1182796671 22:32995992-32996014 CAGCTGCACCAGAAGGAGGAGGG + Intronic
1182931456 22:34178253-34178275 GAGGGGGATAAGGAGGAGGAAGG - Intergenic
1183284490 22:36953534-36953556 CAAGGGGAGCAGGAGGAGGGTGG + Intergenic
1183320150 22:37160325-37160347 CAGTGGGTACAGGAGAAGGTGGG + Intronic
1183347867 22:37317946-37317968 CAGTGGGGCCAGTAGGAGACAGG + Intergenic
1183353260 22:37345047-37345069 CAGTGGGACCCAGAGGAGACAGG - Intergenic
1183422960 22:37723057-37723079 CAGTGAGACCTGTAGGAGGAGGG + Intronic
1183715817 22:39532822-39532844 CAGAGGGATCCGGAGGGGGATGG + Exonic
1184021797 22:41826200-41826222 CAGTGGGGCCAGCAGCAGGGTGG - Exonic
1184080100 22:42213320-42213342 CAGAGCCTCCAGGAGGAGGAGGG - Exonic
1184236903 22:43187414-43187436 CGGGGGGGCCGGGAGGAGGACGG - Intergenic
1184327182 22:43797816-43797838 CAGAGGGAGCCGGGGGAGGATGG - Intronic
1184655027 22:45936754-45936776 CACTCTGACCATGAGGAGGATGG + Intronic
1184996510 22:48211028-48211050 CTGTGGGAGCAAGAGGAGAAGGG + Intergenic
1185075037 22:48678427-48678449 CAGAGGAACCAGGAAGAGGTCGG + Intronic
1185112030 22:48905490-48905512 GACTGGGACCAGGAGTGGGAGGG - Intergenic
1185234770 22:49705352-49705374 CAGGAGAACCACGAGGAGGACGG + Intergenic
1185279865 22:49965445-49965467 CAGTTGGCCCAGGAGCAGGTGGG - Intergenic
949944215 3:9177446-9177468 CTGGGGGACCTGGAGGAGGCAGG + Intronic
950114379 3:10441155-10441177 CAGTGTAGCCAGGGGGAGGAAGG - Intronic
950158535 3:10742214-10742236 CAGCGGGAGGAGGAGGAGGAAGG - Intergenic
951216204 3:20027660-20027682 GAGTGGGAAAAGAAGGAGGAAGG + Intergenic
951393970 3:22141663-22141685 CTGGGGGAGGAGGAGGAGGAGGG + Intronic
952036243 3:29205625-29205647 AAATGGGACCAGGAGAAGTAAGG - Intergenic
952123173 3:30268497-30268519 CACTGGTACCAAGAGGAGGCTGG - Intergenic
953365420 3:42340458-42340480 GAGGGGGAGGAGGAGGAGGAGGG + Intergenic
953633004 3:44635844-44635866 CAGTGGGAGGAGGAGATGGATGG + Intronic
954366836 3:50150980-50151002 GGGTGGCACCAGGAGGAGGCAGG - Intergenic
954436443 3:50498807-50498829 CAGTGGGCCCAGGAAGTGGAGGG - Intronic
954595771 3:51822993-51823015 CAGTGAGTCCAAGAGGTGGAAGG - Intronic
955753240 3:62203569-62203591 GAGCGGGAGCACGAGGAGGATGG + Exonic
955989909 3:64615446-64615468 CGGTGGGACCCAGAGGAGAAGGG - Exonic
956201787 3:66713971-66713993 CAGTGGGGAAATGAGGAGGATGG - Intergenic
956429125 3:69166593-69166615 TACTGGGACTAGGAGGGGGATGG - Intergenic
957335501 3:78822689-78822711 AAGTTGGACCAGAATGAGGAAGG - Intronic
959664135 3:108902688-108902710 CAGCTGGTCCAGGAGGAGGACGG - Intergenic
960992251 3:123319614-123319636 AACCAGGACCAGGAGGAGGAGGG - Intronic
961077702 3:123997260-123997282 CAGAGGTAGCAGGAAGAGGAGGG - Intergenic
961306865 3:125964022-125964044 CAGAGGTAGCAGGAAGAGGAGGG + Intergenic
961534374 3:127560679-127560701 CAGTGGGAACAGGAAGGGCAAGG - Intergenic
961642183 3:128371627-128371649 CAGTGGGCACATGGGGAGGAGGG + Intronic
961821616 3:129578282-129578304 GGGTGGGGCCAGGAGGAGGCCGG - Intronic
962137783 3:132755823-132755845 AAGAGGGACCAGAAGCAGGAAGG + Intergenic
962644262 3:137420386-137420408 CAGTGTGTCCAGGAGGAGAAGGG - Intergenic
962708232 3:138064871-138064893 CAGAAGGGCCAGGAGGAAGAAGG + Intronic
962876997 3:139542731-139542753 CAGAGAGATGAGGAGGAGGAAGG + Intergenic
963039168 3:141056087-141056109 CATTGGAGCCAGGAGGAGGCAGG + Intronic
963271166 3:143287080-143287102 AAGTGGGACCAGAAGGAAGGAGG - Intronic
963373604 3:144434689-144434711 CACTTGGGACAGGAGGAGGAGGG + Intergenic
963700220 3:148616954-148616976 CACTGGGACCTGTTGGAGGAGGG - Intergenic
963918651 3:150884818-150884840 CAGTGGGCTCCAGAGGAGGAAGG - Intronic
964229625 3:154449766-154449788 CAGTGGGGCCTGTAGGGGGAGGG - Intergenic
964720586 3:159764650-159764672 GAGTGGGCGCCGGAGGAGGACGG + Exonic
964886763 3:161492438-161492460 CAGTGGGACAGGGAGGAAAAGGG - Intergenic
965827568 3:172746120-172746142 CAGGGAGACCAAGAGGAGGAAGG + Intergenic
965920386 3:173906278-173906300 CAGTGGGACAGGGAGGAGAAAGG - Intronic
966221982 3:177560258-177560280 AGGTGGGACCTGGAAGAGGAAGG - Intergenic
966402543 3:179562687-179562709 CAGTGGGAGAAGAAGGAGGAAGG - Intergenic
966695279 3:182783750-182783772 CAGAGGGGGCAAGAGGAGGAAGG + Intergenic
966879978 3:184344744-184344766 CAGTGGGCCCAGGCTGCGGAAGG - Exonic
966908476 3:184544503-184544525 GAGGGGGAGGAGGAGGAGGAGGG - Intronic
966908524 3:184544619-184544641 GAGGGGGAGAAGGAGGAGGAGGG - Intronic
966956497 3:184885822-184885844 CAGAGGGAGCAGAAGAAGGAGGG - Intronic
966981353 3:185139125-185139147 GAGGGGGAGCGGGAGGAGGAAGG + Intronic
968903590 4:3442054-3442076 CAGCAGGAGGAGGAGGAGGAAGG - Exonic
968977844 4:3831110-3831132 CAGTGAGACCAGGAAGGGGAGGG + Intergenic
968983278 4:3862496-3862518 CAGTGGGGGCAGAAAGAGGAGGG - Intergenic
969110585 4:4841718-4841740 TAGTGGGACGGGGAGGAGGCTGG - Intergenic
969207611 4:5658930-5658952 TGCTGGGACCAGGAGGAGGGAGG - Intronic
969327354 4:6451735-6451757 CACTGAGGCCGGGAGGAGGAGGG - Intronic
969360496 4:6660360-6660382 CACTGGGACTGGGAGGAAGAAGG + Intergenic
969365196 4:6690125-6690147 CAGAGAGGCCAGGAGGAGGGCGG - Intergenic
969454721 4:7294717-7294739 GAGGGGGAGGAGGAGGAGGAGGG - Intronic
969454792 4:7294899-7294921 GAGGGGGAGGAGGAGGAGGAGGG - Intronic
969657947 4:8508863-8508885 CGGCGGGAGGAGGAGGAGGAAGG - Intergenic
969689109 4:8694554-8694576 CAGGGAGAGCAGGTGGAGGAAGG + Intergenic
970444560 4:16112834-16112856 CAGTTGAACCCAGAGGAGGAGGG - Intergenic
970597341 4:17612530-17612552 CAGAGAGAGAAGGAGGAGGAGGG + Intergenic
972541575 4:40043701-40043723 CGGCAGGAGCAGGAGGAGGAGGG - Intergenic
972828249 4:42786370-42786392 CTCTTGGACCAGGAGCAGGAAGG - Intergenic
973774079 4:54229922-54229944 CTGGGGGACCAGGGGGAGGTGGG + Intronic
973981932 4:56314703-56314725 CTGGGGGAAGAGGAGGAGGAGGG + Exonic
974112201 4:57538051-57538073 GAGGAGGATCAGGAGGAGGAGGG - Intergenic
974229253 4:59088889-59088911 GAGGGGGAGGAGGAGGAGGAAGG - Intergenic
974389624 4:61249429-61249451 CAGGAGGAGGAGGAGGAGGAGGG - Intronic
975615483 4:76242324-76242346 CAGTGGGAGCAAGAGAAAGAGGG - Intronic
977932394 4:102762551-102762573 CAGTAGGACCTTGAAGAGGAGGG - Intergenic
978337732 4:107687903-107687925 CAGAGGGACCATAAGGAAGATGG - Intronic
978351590 4:107825266-107825288 CGGAGGGGCCAGGAGGAGGATGG + Intronic
978486850 4:109264230-109264252 TAGTGCGACCAGGAGAGGGAAGG + Intronic
982169090 4:152643933-152643955 GAGTGGGAGGAGCAGGAGGAAGG - Intronic
982695828 4:158599269-158599291 GTGAGGGACCAGGAAGAGGAGGG - Intronic
983205062 4:164902895-164902917 CAGTGGGAACAGGGTCAGGAGGG + Intergenic
984293083 4:177819624-177819646 CAGTGGGACAAGGAAAATGATGG - Intronic
984675975 4:182548140-182548162 CTGTGAGCCCAGGAGGTGGAGGG + Intronic
984845410 4:184104045-184104067 CAGTGCGCCCAGGCTGAGGAGGG + Intronic
985828921 5:2213533-2213555 CTTTGGGACCAGGAAGGGGAGGG + Intergenic
986032443 5:3906749-3906771 CTGTGGGACCAGGAGGAGCCAGG + Intergenic
986796926 5:11221831-11221853 AAGTGTCACCAGGAGGAGAAAGG + Intronic
986858820 5:11903744-11903766 CAGCGGCAAGAGGAGGAGGACGG + Intronic
987032882 5:13991587-13991609 GAGGGGGAAGAGGAGGAGGAAGG + Intergenic
987589477 5:19904823-19904845 TTGTGGGAACAGGAGGAGGAAGG + Intronic
988172791 5:27681382-27681404 CAGTGGGGCCTGGAGAAGGGTGG + Intergenic
988497764 5:31759144-31759166 CAATGGGAGGAGGTGGAGGAGGG - Intronic
988873539 5:35417977-35417999 CAGAGGGAAGAGGAGGAGAATGG - Intergenic
989090359 5:37724059-37724081 CCGGGGGACCAGGGGAAGGAAGG - Intronic
989983164 5:50666903-50666925 GAGGGGGAGGAGGAGGAGGAGGG - Intronic
990494942 5:56338023-56338045 GAGAAGGAGCAGGAGGAGGAGGG - Intergenic
992152087 5:73914824-73914846 CAGTGAGTCCAGGAGGTGGATGG - Intronic
992583436 5:78206506-78206528 CAGTAGGGCAAGGAGGAAGAAGG + Intronic
992737867 5:79742021-79742043 AAGAGGGAGGAGGAGGAGGAAGG - Intronic
993172066 5:84431556-84431578 CAGGTGGACCAGGAGGGGCATGG - Intergenic
993442794 5:87977637-87977659 TAGTGGGAGCAGGAGGAAGGGGG - Intergenic
995631383 5:114136547-114136569 CAGTGGAACCTGGTGGAGGGAGG + Intergenic
997207897 5:132060720-132060742 GAGTTGGAGCAGGAGCAGGACGG - Exonic
998171237 5:139873033-139873055 AAGTGAGAGGAGGAGGAGGAGGG + Intronic
998199428 5:140107864-140107886 CAGGGGAAGGAGGAGGAGGAGGG + Intronic
998451173 5:142235689-142235711 CGGTGGGGCCAGGAGGAAGTGGG - Intergenic
998524672 5:142831647-142831669 GAGAGGGAGGAGGAGGAGGAGGG - Intronic
999326911 5:150649497-150649519 CAGAGGGACCAGGGGGAGGTAGG + Exonic
1000028754 5:157383313-157383335 CAGAGGGACCAGGTGGAGCGGGG - Exonic
1000988785 5:167890106-167890128 CAGAGGGCCCAAGAGGAGAAGGG - Intronic
1001414482 5:171535301-171535323 CTGTGGGGGCAGGAGAAGGATGG + Intergenic
1001594287 5:172887894-172887916 GAGTGGAAACAGGAGGAGGCAGG + Intronic
1001706044 5:173741758-173741780 GAGGGGGAGGAGGAGGAGGAAGG + Intergenic
1001758120 5:174186301-174186323 CAGAGGGAGCAGGAGGAGCCGGG - Intronic
1002118227 5:176981703-176981725 AGGTGGGACCAGGAGAAGGAAGG + Intronic
1002206657 5:177567714-177567736 CAGTGGGACCAGGAAGTGAGTGG - Intergenic
1002715751 5:181225868-181225890 CAGTGGGACCAGGAGGAGGAGGG + Intronic
1002897684 6:1389157-1389179 CCGGCGGGCCAGGAGGAGGAAGG + Intergenic
1002956857 6:1874014-1874036 CAGACGGACCAGTGGGAGGAAGG + Intronic
1003894238 6:10591665-10591687 GAGTGGTACTAGCAGGAGGAGGG - Intronic
1003980013 6:11380576-11380598 CAGTGAGGCCTGGAGGAGGGAGG + Intronic
1004057787 6:12158542-12158564 TTGTGGGGCAAGGAGGAGGATGG + Intronic
1004097369 6:12570809-12570831 GTGTGAGAGCAGGAGGAGGAAGG + Intergenic
1004750497 6:18557423-18557445 CACTTGAACCAGGAGGTGGAAGG + Intergenic
1004866294 6:19856566-19856588 CAGTGGTGCCAGGAGGAGGGGGG + Intergenic
1005471179 6:26164166-26164188 CAGTGGTAGCAGGAGGTGGCAGG + Intronic
1005917346 6:30364796-30364818 CAGGGAGACCAGGAGGTGGCAGG + Intergenic
1007198266 6:40082438-40082460 GAGTGGTCCCAGGTGGAGGAGGG - Intergenic
1007747387 6:44051453-44051475 CAGTGGGGCCTGGGGTAGGAGGG + Intergenic
1007978869 6:46130090-46130112 AAGGGGGACCTGGAGGAAGAGGG - Exonic
1008759169 6:54833473-54833495 GAGGGGGAAAAGGAGGAGGAGGG + Intergenic
1009188232 6:60599284-60599306 CTGTAGGAACAGGATGAGGAGGG + Intergenic
1010585819 6:77657885-77657907 TAGTGTGAACAGGAGGAGGAGGG - Intergenic
1013922215 6:115419799-115419821 CAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1014242439 6:119032616-119032638 GAGGGGGAGGAGGAGGAGGAAGG + Intronic
1014842373 6:126235685-126235707 CAGTGGGGCCTGTTGGAGGATGG + Intergenic
1016589409 6:145728320-145728342 CAGAGGAAGCAGGAGGATGAAGG + Intronic
1017276437 6:152574479-152574501 AAGTGAGAGCAAGAGGAGGAAGG - Intronic
1017927758 6:158924800-158924822 GAGAGGGAGAAGGAGGAGGAAGG + Intergenic
1017967485 6:159279082-159279104 CAGTGATACCAGGAGAAGGTTGG + Intergenic
1018398769 6:163401933-163401955 CAGTGGGCCCTGGAAGAGGCTGG + Intergenic
1018784732 6:167099117-167099139 CAATGGGAGCAAGAGGAAGAAGG + Intergenic
1018922353 6:168184116-168184138 CTCTGGGACCAGAAGGAGGAAGG + Intergenic
1019169692 6:170125907-170125929 CAGCTGGACGAGGAGGAGCAGGG - Intergenic
1019440990 7:1046699-1046721 CAGAGGGACAAGGTGGAGGTGGG + Intronic
1019536404 7:1531606-1531628 CAGTGGGAGCGGGAAGAGGCCGG - Intronic
1019564082 7:1671004-1671026 CAGAGGGACGAGGACGAGGATGG - Intergenic
1020072047 7:5233580-5233602 CAATGGGACCAAGAGCTGGATGG + Exonic
1020137287 7:5594314-5594336 CAGCGGGAGGAGGTGGAGGAAGG - Intronic
1020847617 7:13306909-13306931 CAGTGGGGCCAGTTGGGGGATGG + Intergenic
1021623640 7:22571992-22572014 ATGTGGGCCCAGGAGGAAGAAGG + Intronic
1022384657 7:29889990-29890012 CAATGAAATCAGGAGGAGGAGGG - Intronic
1023758780 7:43444679-43444701 GAGAAGGAGCAGGAGGAGGAGGG + Exonic
1023828576 7:44025988-44026010 CAGTGAGATCAGGATGAGGGTGG + Intergenic
1023860362 7:44214652-44214674 CAGCGGGATCAGGATGGGGATGG - Intergenic
1023878724 7:44306865-44306887 AGGTGTGAGCAGGAGGAGGAGGG + Intronic
1023878754 7:44306982-44307004 GGGTGTGAGCAGGAGGAGGAGGG + Intronic
1024064166 7:45718879-45718901 CAGTGGGCTCAGCAGAAGGAAGG + Exonic
1024166010 7:46731084-46731106 CAGTGGGACCAACTTGAGGATGG + Intronic
1024254672 7:47531859-47531881 GAGTGGGGCCAGGAGCAGGCAGG + Intronic
1024921657 7:54563509-54563531 CAGTGTCCCCAGCAGGAGGAAGG + Intronic
1025228329 7:57182211-57182233 GAGGGGGAGGAGGAGGAGGAGGG - Intergenic
1025230676 7:57201620-57201642 CAGTGTGGCCAGGAGGAGGCAGG - Intergenic
1025928990 7:65980199-65980221 CAGTGCGGCCAGGAGCAGGCAGG - Intronic
1026471079 7:70694493-70694515 GAGAGGGAGGAGGAGGAGGAGGG - Intronic
1026941681 7:74290705-74290727 CTGTGGGCAGAGGAGGAGGAGGG + Intronic
1027247170 7:76375066-76375088 GAGAGGGACCAGGAAGAGCAGGG + Intergenic
1028488437 7:91385196-91385218 CACTGGGGAGAGGAGGAGGAAGG - Intergenic
1028753645 7:94410434-94410456 CACTGGGACCAGGAGGACCTTGG - Exonic
1029200648 7:98837052-98837074 CAGAGTGACCAGGTGGAGGTTGG - Intergenic
1029288573 7:99484167-99484189 GAGTGGAATCAGGAAGAGGAAGG + Intronic
1029497390 7:100903385-100903407 AAGTGCGCCCAGGACGAGGATGG - Intergenic
1029738871 7:102480268-102480290 CAGTGAGATCAGGATGAGGGTGG + Intergenic
1029750378 7:102539626-102539648 CAGGAGGACCGTGAGGAGGACGG + Intronic
1029756872 7:102579431-102579453 CAGTGAGATCAGGATGAGGGTGG + Intronic
1029768330 7:102638734-102638756 CAGGAGGACCGTGAGGAGGACGG + Exonic
1029774811 7:102678491-102678513 CAGTGAGATCAGGATGAGGGTGG + Intergenic
1030106317 7:105990398-105990420 AGGTGGGACGTGGAGGAGGAAGG - Intronic
1030894226 7:115037615-115037637 CAGTGGGGAAAGGAGGAGGGTGG + Intergenic
1030914748 7:115298355-115298377 CAGTGGGATGAGGAGCAGTAGGG + Intergenic
1031597305 7:123662861-123662883 GAGGGGGAGGAGGAGGAGGAGGG - Exonic
1032240091 7:130153556-130153578 CACGGGGACCGGTAGGAGGAAGG + Intergenic
1032362701 7:131271166-131271188 CAGTGGGACCAGGAAAAGGAGGG + Intronic
1032794660 7:135268190-135268212 CAGTGGACCCAGGAGGAAGGAGG - Intergenic
1032973717 7:137196528-137196550 CCGAAGGACCAGGAGCAGGACGG - Intergenic
1033369322 7:140694769-140694791 CACTGGGCCCGTGAGGAGGAAGG - Exonic
1034267095 7:149786319-149786341 GAGGGAGACCAGGAGGAGGGAGG - Intergenic
1034274638 7:149818663-149818685 CAGGGGGACCAGGAGGACCATGG - Intergenic
1034280526 7:149850808-149850830 CAGGTGGATCAGAAGGAGGAAGG + Intronic
1034465160 7:151223691-151223713 CAGTGGGGGCTGGAGGATGAGGG - Exonic
1034720777 7:153290188-153290210 GAGGGGGAGGAGGAGGAGGAAGG + Intergenic
1034907756 7:154965563-154965585 GAGTGGGCCTAGGAGGAGGAGGG - Intronic
1035117456 7:156536600-156536622 GAGAGGGAGCAGGAGCAGGAGGG + Intergenic
1035595312 8:853233-853255 CAGAGGGAGAAGGTGGAGGAGGG + Intergenic
1035636973 8:1155007-1155029 GAGTGGGAACAGAAGCAGGATGG - Intergenic
1036684790 8:10902499-10902521 CAGAGGGACCAGACGGAGAAAGG - Intronic
1036687904 8:10924095-10924117 GAGAGGGCCCAGGAGGAGGAGGG - Intronic
1036707480 8:11056096-11056118 CACTGGGTCCAGGAGGAGTCGGG - Intronic
1036914909 8:12796199-12796221 CGGTGGGCCCAGGCAGAGGAGGG - Intergenic
1037294180 8:17383308-17383330 CAGAGGGAGCAAGAGGAGGAAGG + Intronic
1037454627 8:19051189-19051211 GATTGGGACCAGAGGGAGGAGGG - Intronic
1037738593 8:21586715-21586737 CACTGGGGCCTGGTGGAGGAGGG - Intergenic
1037757614 8:21721435-21721457 CAGTGGGTCCCTGTGGAGGAAGG + Intronic
1037822643 8:22142327-22142349 CAGTGGGTCCAGGAGGGAAAGGG + Intergenic
1037935679 8:22913581-22913603 CTGAGGGAAGAGGAGGAGGAAGG - Intronic
1037941714 8:22956468-22956490 TGGCTGGACCAGGAGGAGGAGGG - Intronic
1038103905 8:24412132-24412154 CAGTGGGGCCAGTTGGAGGGTGG + Intergenic
1038313727 8:26465426-26465448 CAGAGGGACCAGGGGGTGGGAGG - Intronic
1038760179 8:30378654-30378676 CTTTGGGATCAGGTGGAGGATGG - Intergenic
1039088763 8:33806028-33806050 GAGTGGGACAAGGAGGAAGAGGG - Intergenic
1039277850 8:35952970-35952992 CAGTGGGCTCAGGAGTGGGAGGG - Intergenic
1039366660 8:36935183-36935205 CAGTGGGAAGAGGGGGAAGACGG - Intronic
1039410626 8:37352286-37352308 ATGTGGCTCCAGGAGGAGGAGGG + Intergenic
1039817837 8:41110513-41110535 CAGTGAGACCTGGCTGAGGAAGG + Intergenic
1039971761 8:42326460-42326482 CAGTGGCACCGGGAGGAGGGTGG - Intronic
1040079772 8:43274918-43274940 GAGGAGGAGCAGGAGGAGGAGGG - Intergenic
1040385065 8:46909531-46909553 AGGTGGGACCATCAGGAGGATGG - Intergenic
1040443900 8:47473804-47473826 GTGAGGAACCAGGAGGAGGATGG + Intronic
1041433284 8:57808693-57808715 AAGTGGGCCCAGGAGAAGAATGG + Intergenic
1041520606 8:58751646-58751668 CATTGGGTCCTGGAGGAGGGGGG + Intergenic
1041694049 8:60716606-60716628 CAGAGGGACCGGTTGGAGGAAGG - Intronic
1041916757 8:63146271-63146293 AGGTGGAATCAGGAGGAGGAGGG + Intergenic
1043778193 8:84297189-84297211 CAGTGGGAGGAGGGAGAGGAAGG - Intronic
1044090330 8:87992536-87992558 GAGTAGGAAGAGGAGGAGGAGGG - Intergenic
1044416287 8:91944033-91944055 TAGTGGGACCTAGAGGTGGAAGG + Intergenic
1045056406 8:98371970-98371992 GAGTGGGATCAGGGGGAGGGGGG + Intergenic
1045378639 8:101600786-101600808 CAGTGTGACCAGGGAGAGGCAGG + Intronic
1045788541 8:105955011-105955033 CAGTGGGGGCAGGAGCAGGATGG + Intergenic
1047283290 8:123464461-123464483 CAGCGGCATGAGGAGGAGGAAGG + Intronic
1047498727 8:125426833-125426855 CTGTGGGAAGAGGGGGAGGAAGG + Intergenic
1047682072 8:127264510-127264532 TGGTGGGAGCAGGAGGAAGAGGG + Intergenic
1047960840 8:130010629-130010651 CAGTGGGAGCAGGAAGGGGTGGG - Intronic
1048357780 8:133667581-133667603 GAGTGGGAGGAGGAGGAAGAGGG - Intergenic
1049157602 8:141076373-141076395 CAATGGGAGGGGGAGGAGGAAGG + Intergenic
1049191063 8:141287872-141287894 CAGGGGCACCTGGAGGAAGACGG + Intronic
1049324830 8:142016451-142016473 CAGAGAGGCCTGGAGGAGGACGG - Intergenic
1049386076 8:142343793-142343815 GAGGGGGAGGAGGAGGAGGAGGG + Intronic
1049409578 8:142466482-142466504 CAGTGGCCCGAGGAGGAGGGAGG + Intronic
1049630513 8:143652657-143652679 CAGTGGGGACAGGAGGAGGCAGG + Exonic
1049822124 8:144641831-144641853 CAGTGCAGCCACGAGGAGGAGGG + Intergenic
1049949169 9:627699-627721 CAGGGGGACCAGAGGGTGGATGG + Intronic
1050130418 9:2406551-2406573 CTGGGGGGCCAGGAGCAGGAAGG + Intergenic
1050648939 9:7754397-7754419 CACTGTGCCCAGGAGGAAGAAGG + Intergenic
1051374113 9:16386883-16386905 CAGAGAGACCAGCAGGAGGCAGG + Intergenic
1051447811 9:17159668-17159690 AACTGGGAACAGGAGGAAGAGGG + Intronic
1051998008 9:23242707-23242729 CAGTAGGGCCAGGAGGGAGAAGG + Intergenic
1052918163 9:33939854-33939876 GAGGGGGAGGAGGAGGAGGAGGG + Intronic
1052938080 9:34110107-34110129 GAGTGGGAGCAGGGGGAAGAAGG + Intronic
1053014482 9:34654202-34654224 AAGGGGGAGCAGAAGGAGGAAGG - Intronic
1053480547 9:38413434-38413456 CAGTGGGAGGAGGAGGAAGGAGG - Intronic
1054826604 9:69579776-69579798 AAGTGGGTCAAGGAAGAGGAAGG + Intronic
1055144155 9:72912671-72912693 CAGTGGGACCAGAACTGGGAAGG - Intronic
1055529681 9:77171499-77171521 AAGTAGGTCCAGGAGAAGGATGG - Intergenic
1055581428 9:77711025-77711047 GAGAGGGAGGAGGAGGAGGAGGG - Intergenic
1055581454 9:77711079-77711101 AAGGGGGACAGGGAGGAGGAGGG - Intergenic
1056071695 9:82993805-82993827 CAGTGGGTCCAGCTGGTGGAGGG - Intronic
1056297329 9:85206003-85206025 CACTGGTCCCAGGAGGAAGATGG + Intergenic
1057131612 9:92657940-92657962 CTGTGGGAGCAGGCGGAGGCTGG - Intronic
1057181560 9:93033410-93033432 GAGAAGGAGCAGGAGGAGGAGGG - Intronic
1057230519 9:93318844-93318866 CAGTGGGAGGTGGAGGAGGCTGG - Intronic
1057505319 9:95628516-95628538 GAGGAGGACGAGGAGGAGGAGGG - Intergenic
1057676083 9:97137284-97137306 CAGTGGGAGCTGGGGGTGGAGGG - Intergenic
1057696753 9:97328625-97328647 CAGAGGGAGCACGATGAGGAAGG - Intronic
1057974945 9:99595483-99595505 CCATGGGACCCTGAGGAGGAAGG - Intergenic
1058444008 9:105037947-105037969 AAATTGGACCAGTAGGAGGAAGG - Intergenic
1058907753 9:109495510-109495532 GAGTGGGGCCAGGAGCAAGAGGG - Intronic
1059438079 9:114288452-114288474 CAGGGGGAGCAGGGCGAGGACGG + Exonic
1059730213 9:117049650-117049672 CACTGGGAAGAGGAAGAGGAAGG + Intronic
1059999852 9:119948405-119948427 CACTGGTTCCAGGAGGAGGATGG - Intergenic
1060992687 9:127857803-127857825 CAGAGGAGGCAGGAGGAGGAGGG + Intergenic
1061091310 9:128428152-128428174 CTGTGGGACCAGAGGGAGAAAGG - Intronic
1061204814 9:129156750-129156772 CAGGAGGAAGAGGAGGAGGAGGG - Intergenic
1061670559 9:132185872-132185894 GAGTGGGAGGAGGAGGAGGAGGG + Intronic
1061860380 9:133464875-133464897 CAGTGGCACCAGCACCAGGAAGG - Intronic
1062030646 9:134360446-134360468 CGGCGGGACCAGGGGAAGGATGG - Intronic
1062068161 9:134540041-134540063 CTGTGGGACAGGGAGGAGGTAGG - Intergenic
1062074738 9:134579769-134579791 AAGGGGGAAGAGGAGGAGGAGGG + Intergenic
1062074755 9:134579811-134579833 AAGGGGGAAGAGGAGGAGGAGGG + Intergenic
1062074773 9:134579854-134579876 AAGGGGGAAGAGGAGGAGGAGGG + Intergenic
1062162875 9:135089358-135089380 CAGTAGGGCCAGCAGCAGGATGG + Intronic
1062207087 9:135343180-135343202 CAGTGGGACCTGGTGGAGGGTGG - Intergenic
1062261363 9:135664807-135664829 CTGTGAGACCAGGAGGAGCCTGG - Intronic
1062546254 9:137064948-137064970 CAGGGGGGCCCGGAGGAGGACGG + Exonic
1062722933 9:138053773-138053795 GAGTGGGGCCATGAGGGGGAAGG - Intronic
1185556667 X:1026921-1026943 GAGAGGGAGGAGGAGGAGGAGGG - Intergenic
1185593499 X:1293789-1293811 CACTGGGTCCAGGTGGAGGTGGG - Intronic
1185593520 X:1293875-1293897 CACTGGGTCCAGGTGGAGGTGGG - Intronic
1185593549 X:1294005-1294027 CACTGGGTCCAGGTGGAGGTGGG - Intronic
1186967332 X:14802206-14802228 CAGTCAGACAAGGGGGAGGAAGG + Intergenic
1186979118 X:14939936-14939958 CAGTGGGAGGGGGAGGAGGGAGG - Intergenic
1187007614 X:15247870-15247892 CAGTGAGAGTAGGAGGAAGAAGG + Intronic
1187163791 X:16786731-16786753 CAGTGGGAGCAGGTGGGGGGGGG + Intronic
1187267852 X:17752282-17752304 CACCAGGACCACGAGGAGGAGGG + Intronic
1187289564 X:17940068-17940090 CAGTGAGAGCAGAAGCAGGAGGG - Intergenic
1187447683 X:19373174-19373196 AGGAGGGGCCAGGAGGAGGAGGG + Intronic
1187538378 X:20165271-20165293 CAGTTGGACAAAGAGGAGGGAGG - Intronic
1188134199 X:26474229-26474251 AAGAGGGACCAGTATGAGGAGGG + Intergenic
1188601633 X:31973527-31973549 CAGTGGGGAGAAGAGGAGGATGG - Intronic
1189566724 X:42249415-42249437 GAGTGGGATCAGGGGGAGCACGG - Intergenic
1190569643 X:51768334-51768356 CAGTGAGGCCAGGAGGTGGTGGG + Intergenic
1190727458 X:53198931-53198953 AAGTGGGGCAAGAAGGAGGATGG - Intronic
1191044244 X:56119241-56119263 AAGTGGGAAAAGGAGGAAGAGGG + Intergenic
1191915510 X:66197744-66197766 CAGTGGGACCGGCATGAGGGGGG - Exonic
1191954782 X:66632437-66632459 CAGGAGGAGGAGGAGGAGGAGGG + Intronic
1192261096 X:69506198-69506220 CAGTGGGACCGGGAGAAAAAAGG + Intronic
1192435247 X:71139358-71139380 CATGGGGACCAGAATGAGGATGG + Intronic
1192608971 X:72548560-72548582 CAGTGAGACAAGGAGGTGGCAGG - Intronic
1192847999 X:74925493-74925515 GAGTAGGAGGAGGAGGAGGAAGG - Intergenic
1194318474 X:92411949-92411971 GAGTGGGAGGAGGAGGAGGAGGG + Intronic
1195082552 X:101385268-101385290 GAGTGGGAAGAGGAGGAGGTTGG + Intronic
1195728565 X:107941932-107941954 CTTTGGGAGCTGGAGGAGGAAGG - Intergenic
1196058017 X:111377096-111377118 AAGTGGAGGCAGGAGGAGGAGGG - Intronic
1196117861 X:112016549-112016571 ATGTGGGACCAGGAAGAGAAAGG - Intronic
1196824710 X:119732019-119732041 CAGCAGGACCAGCAGAAGGAAGG + Intergenic
1197726116 X:129777592-129777614 CTGCGTGACCAGGAGCAGGAGGG - Intergenic
1197804200 X:130383716-130383738 CAGTAAGGGCAGGAGGAGGAGGG + Intergenic
1198084455 X:133269111-133269133 GGCTGGGAGCAGGAGGAGGAGGG - Intergenic
1199490855 X:148399024-148399046 CAGTGGGACCAGTAGGTAGAAGG - Intergenic
1199737446 X:150696883-150696905 AAGTGGGAGCAGGTGGAGGAAGG + Intronic
1200002511 X:153069324-153069346 AAGTAGGAGGAGGAGGAGGAAGG + Intergenic
1200005213 X:153080686-153080708 AAGTAGGAGGAGGAGGAGGAAGG - Intergenic
1200125711 X:153813431-153813453 CAGGAGGACCAGGAGGATGTGGG + Intronic
1201235710 Y:11908902-11908924 CTGTGGGCCCTGGAGGAGAAAGG + Intergenic