ID: 1002717408

View in Genome Browser
Species Human (GRCh38)
Location 5:181236190-181236212
Sequence CCCTGTACTGAGGTTTCTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002717403_1002717408 -2 Left 1002717403 5:181236169-181236191 CCGCATGTTGAACCATTCCATCC No data
Right 1002717408 5:181236190-181236212 CCCTGTACTGAGGTTTCTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002717408 Original CRISPR CCCTGTACTGAGGTTTCTAT TGG Intergenic
No off target data available for this crispr