ID: 1002719305

View in Genome Browser
Species Human (GRCh38)
Location 5:181247961-181247983
Sequence TGCCAGCTAAAACTCTGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 164}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002719302_1002719305 0 Left 1002719302 5:181247938-181247960 CCAGGACCAGAGGGCCTGCTGAC 0: 1
1: 0
2: 1
3: 14
4: 186
Right 1002719305 5:181247961-181247983 TGCCAGCTAAAACTCTGTGCAGG 0: 1
1: 0
2: 0
3: 8
4: 164
1002719303_1002719305 -6 Left 1002719303 5:181247944-181247966 CCAGAGGGCCTGCTGACTGCCAG 0: 1
1: 0
2: 6
3: 44
4: 299
Right 1002719305 5:181247961-181247983 TGCCAGCTAAAACTCTGTGCAGG 0: 1
1: 0
2: 0
3: 8
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002719305 Original CRISPR TGCCAGCTAAAACTCTGTGC AGG Intronic
901144379 1:7055256-7055278 TACCAGTTAATACTATGTGCTGG - Intronic
903460374 1:23516625-23516647 TGCAAGCTCAAACCCTGGGCTGG + Intronic
903487307 1:23699946-23699968 TGGCAGCTTAAACTATGTGTGGG - Intergenic
904412839 1:30335464-30335486 TGCCAGACAAAACTCTTTGGAGG - Intergenic
904995438 1:34627883-34627905 TTCCAGCAAAACCTCTGTCCTGG - Intergenic
905190609 1:36231005-36231027 TACCAACTAACACTCTGTCCAGG - Intronic
908628404 1:66073633-66073655 TGCCAACTAAAACTTGGAGCTGG - Intronic
911128957 1:94369781-94369803 TCCGAGCTCAAACTCTTTGCTGG + Intergenic
917460041 1:175221817-175221839 TGCCCGCTTAAGCTCTCTGCCGG - Intergenic
921662354 1:217819843-217819865 GGCCAGCTAAAACTCCTTGAAGG + Intronic
921791561 1:219296308-219296330 TTCCAGCTGTCACTCTGTGCAGG + Intergenic
924836003 1:247648119-247648141 TGCCAGTTAAACCTCTGCTCTGG + Intergenic
1065377379 10:25057319-25057341 TTACAGCTAACACTCTGTGAGGG + Intronic
1069006608 10:63324389-63324411 TGCCAACTAAGATTCTGTGGAGG + Intronic
1072680881 10:97505596-97505618 TGCCAGATGAAACTCTGTGTTGG - Intronic
1075097465 10:119481934-119481956 TGCCAACAAAAACTGGGTGCAGG + Intergenic
1076249623 10:128975332-128975354 TGCCATGTACAACTCTGGGCAGG - Intergenic
1077476435 11:2792553-2792575 TGCCAGGAAAAGGTCTGTGCGGG + Intronic
1079849994 11:25520556-25520578 TGTTAGCTGAAACTTTGTGCTGG + Intergenic
1080846815 11:36034034-36034056 TGTCAGCAAAGACTCTGTGCAGG - Intronic
1081143784 11:39536293-39536315 TCAGAGCTCAAACTCTGTGCTGG + Intergenic
1084502932 11:69545560-69545582 TGCCAGCTAAGAGTGGGTGCCGG - Intergenic
1084725179 11:70937124-70937146 TACAAGCTAAGACGCTGTGCAGG + Intronic
1091322941 11:134664622-134664644 CGCCAGCTGAGGCTCTGTGCAGG + Intergenic
1091444901 12:539088-539110 TGCCAGCCAAAGCTCGGGGCAGG - Intronic
1091777012 12:3191232-3191254 TGCCAGTTTAAAATCTGTACAGG - Intronic
1093593245 12:20931720-20931742 TACCAGCTCAAACTCTGAACTGG + Intergenic
1095620341 12:44246925-44246947 TGTCACTCAAAACTCTGTGCAGG - Intronic
1098504887 12:71237862-71237884 TACCAGCTAAAACTACTTGCTGG - Intronic
1100358479 12:93854480-93854502 TGCCAGCTCAGAGTCAGTGCGGG + Intronic
1107400395 13:40063645-40063667 TTCCATGTAAAACTCTCTGCAGG + Intergenic
1107535878 13:41331115-41331137 TGACATTTAAAACTCTGTGGTGG - Intronic
1108266417 13:48713341-48713363 TGTGAGCTGAAACACTGTGCTGG - Intergenic
1108266977 13:48720658-48720680 TGTGAGCTAAAACACTGTTCTGG - Intergenic
1108884720 13:55165629-55165651 TGCCAGCCAAAGCACTGTGTTGG - Intergenic
1109180883 13:59212808-59212830 TGCCAGATAAAGGTCTGTGTGGG + Intergenic
1110012019 13:70348450-70348472 TGCCAAGTAAAGCTCTGGGCTGG + Intergenic
1113604079 13:111592419-111592441 TGTCCGCTAAAACTTTGTGGTGG - Intronic
1116684388 14:48019081-48019103 TGAGATCTCAAACTCTGTGCTGG - Intergenic
1117276542 14:54199866-54199888 TCCCAGCTCAAACTCAGTGAAGG + Intergenic
1117831466 14:59755524-59755546 TCCCAGCCTAACCTCTGTGCAGG - Intronic
1120634972 14:86940126-86940148 TGCCAGCTAACATTCTGACCTGG + Intergenic
1120747407 14:88164817-88164839 TCCCAGCAAAAACTCACTGCAGG - Intergenic
1124019858 15:25910070-25910092 TGTCAGCTCCAACTCCGTGCTGG + Intergenic
1124600628 15:31130179-31130201 TGCCAGGTAAGACACTGGGCAGG - Intronic
1126301603 15:47202810-47202832 TACCAGCTAAAAATCTGTAAGGG - Intronic
1129616831 15:77105377-77105399 TCCCAGATAAACCTCTGTACAGG - Exonic
1130085933 15:80778751-80778773 TGCCAGTTACAACTGTGTACAGG - Intergenic
1138078907 16:54069937-54069959 TGCCAGCTATGACTTTGAGCAGG + Intronic
1141234556 16:82203490-82203512 TCCCAAATAAAACTATGTGCAGG + Intergenic
1142473943 17:179173-179195 TGCCAGCTTGAACTGTGGGCTGG - Intronic
1142771858 17:2103883-2103905 TGCCAGCAACACCTCTGTGATGG + Intronic
1143690850 17:8563968-8563990 TTCTAACTAAAACTCTGTGAGGG + Intronic
1144404294 17:14937671-14937693 TGACACCACAAACTCTGTGCTGG - Intergenic
1145101228 17:20079660-20079682 TGCCAGCTCAGACTGGGTGCTGG - Intronic
1146600903 17:34215231-34215253 TGAGATCTCAAACTCTGTGCTGG + Intergenic
1147332412 17:39706686-39706708 TGCCAGCCAACACCCTGTACTGG + Intronic
1148636976 17:49156425-49156447 TGTCAGCAAACACTCTGGGCGGG + Intronic
1149503758 17:57175616-57175638 TTCCAGCCCACACTCTGTGCAGG - Intergenic
1150746186 17:67818744-67818766 TTCCAGCTAAAAGGCTGCGCTGG - Intergenic
1154145911 18:11866073-11866095 AGCCAGCTACATCTCTCTGCTGG + Intronic
1159317006 18:66788429-66788451 TGCCAGCTAACACACTCAGCTGG + Intergenic
1162577427 19:11507064-11507086 TCCCTCCTACAACTCTGTGCTGG - Intronic
1163940044 19:20483077-20483099 TCCAAGCTCAAACACTGTGCTGG - Intergenic
1167111915 19:47467566-47467588 TGACATCTAAGACCCTGTGCTGG + Intronic
925706225 2:6686514-6686536 TGACAGCTAGACCTCTGTGAAGG + Intergenic
927513229 2:23657695-23657717 TGCCAGCCAAAACTCTCTCAGGG - Intronic
927864823 2:26581678-26581700 TGCCAGCTTCAATTATGTGCTGG + Intronic
928399684 2:30968967-30968989 TGCCAGCTAACACTCCCTCCAGG - Intronic
929967864 2:46548965-46548987 TGCCAGCTTAGACTGTGGGCTGG + Intronic
931094678 2:58925882-58925904 TTCCAGCCAACACTTTGTGCAGG - Intergenic
932144287 2:69305192-69305214 TGGCAGCTACAACTCTGCGGGGG + Intergenic
934746925 2:96765415-96765437 TGCCAGCTGAAAGGCTGGGCAGG - Intronic
935604693 2:104959104-104959126 TGCAAGCTCAAACACTGTGCTGG + Intergenic
938156816 2:128948773-128948795 TGAGATCTCAAACTCTGTGCTGG + Intergenic
938259112 2:129882683-129882705 AGCCAGCTAACCCTCTGTCCAGG + Intergenic
938820167 2:134949683-134949705 TGACATCTAAAACTCAGTGAGGG + Intronic
939019906 2:136946472-136946494 TCCGAGCTCAAACACTGTGCTGG + Intronic
939251790 2:139690131-139690153 TGCCAGCTAAAGTTTAGTGCAGG + Intergenic
940456863 2:153912834-153912856 TGCCAGCCAAAGCTCTTTGTAGG + Intronic
941038806 2:160597677-160597699 TACCAGCTACATCTCTATGCTGG + Intergenic
944274829 2:197824218-197824240 AGACACCTAAAACTCTGTGAAGG + Intronic
946050345 2:216856987-216857009 TGACAGCCAAAACTGTGTGTGGG - Intergenic
946787088 2:223258908-223258930 TCAGAGCTCAAACTCTGTGCTGG + Intergenic
1169505202 20:6202702-6202724 TGCCAGCTCAATGCCTGTGCAGG - Intergenic
1174527338 20:51184128-51184150 TTCCAGCAACAACTCTGTGGGGG - Intergenic
1176163065 20:63658348-63658370 TGCCCGCGAAAACTCTGAGCTGG + Exonic
952632177 3:35482603-35482625 TGAGATCTCAAACTCTGTGCTGG + Intergenic
954836466 3:53473432-53473454 TCAGAGCTAAAACACTGTGCTGG + Intergenic
956163822 3:66381550-66381572 AGGCAGCCAAAGCTCTGTGCTGG - Exonic
958771859 3:98434805-98434827 TGCAATCAAAAACACTGTGCTGG + Intergenic
960485912 3:118252822-118252844 TTCCAGATAAAACTCTTTGTGGG + Intergenic
961396061 3:126591488-126591510 TGAGATCTCAAACTCTGTGCTGG + Intronic
963057744 3:141201252-141201274 GGCCTGCTACTACTCTGTGCAGG + Intergenic
965024963 3:163290836-163290858 TGGCAGGTAAGACTGTGTGCAGG + Intergenic
965705749 3:171506209-171506231 TGCCAGCTAAATGCCTGTGAGGG - Intergenic
968933758 4:3598362-3598384 TGCCAGCTGCATCTCTGGGCAGG - Intergenic
972006127 4:34109390-34109412 TTCCAACAGAAACTCTGTGCTGG + Intergenic
973562251 4:52148936-52148958 TGGCAGCTGAAATTCAGTGCTGG - Intergenic
973724849 4:53764695-53764717 TCCCTGCCCAAACTCTGTGCTGG + Intronic
974252962 4:59412595-59412617 TCTCAGCTACAACTCTGGGCAGG - Intergenic
978517755 4:109586947-109586969 TCCCAGCTCAAACACCGTGCTGG + Intronic
981487992 4:145307725-145307747 TGCCAGAGAAAACTGTGTCCAGG + Intergenic
982958431 4:161802820-161802842 TGCCTCCTGAAACTTTGTGCTGG + Intronic
983269758 4:165547446-165547468 TGTCAGCTAAAACTATTTTCTGG + Intergenic
983602678 4:169548479-169548501 TCAGAGCTCAAACTCTGTGCTGG + Intronic
983705719 4:170656296-170656318 TGCCAGATAAAAATCTGGACAGG - Intergenic
986903783 5:12468551-12468573 TGCCAGCCAAAACACTTTGTAGG - Intergenic
987247055 5:16059774-16059796 TTGCAGCTCAAACACTGTGCAGG + Intergenic
988551381 5:32203943-32203965 TGCCAGGTAGAACTCCCTGCAGG + Intergenic
989477915 5:41895401-41895423 AGGCAGCTGTAACTCTGTGCTGG + Intergenic
989560258 5:42842251-42842273 TGCCAGCTAGAACCCTGTGGAGG + Intronic
990168063 5:53017511-53017533 TGCCAGCCAAAGCTCTTTGTTGG + Intronic
990173666 5:53083244-53083266 AGCTAGATAAAACTCAGTGCTGG - Intronic
991994195 5:72371120-72371142 TGCCAGGCAATATTCTGTGCTGG - Intergenic
992626801 5:78643382-78643404 TGCCAGCTAAGACTCTTCTCTGG + Intronic
993476354 5:88370195-88370217 AGCCAGCTAAAACTTTAGGCAGG + Intergenic
993578887 5:89635411-89635433 TGAGATCTCAAACTCTGTGCTGG + Intergenic
994598845 5:101875828-101875850 TGCCTGCTGACATTCTGTGCTGG + Intergenic
994970573 5:106731342-106731364 AGCCAGCCAAAACTCTTTGTAGG - Intergenic
995179111 5:109213934-109213956 TCAGAGCTCAAACTCTGTGCTGG + Intergenic
996509527 5:124303623-124303645 TTCCAGCTAAAAATCTATCCAGG + Intergenic
1001180052 5:169512113-169512135 AGCAAGCTGAAACCCTGTGCAGG + Intergenic
1002719305 5:181247961-181247983 TGCCAGCTAAAACTCTGTGCAGG + Intronic
1002945569 6:1758162-1758184 ATCCTGCTAAAACTCTCTGCCGG + Intronic
1004859374 6:19785928-19785950 TAAAAGCTAAAACTATGTGCAGG + Intergenic
1004859401 6:19786531-19786553 TAAAAGCTAAAACTATGTGCAGG + Intergenic
1006186246 6:32183149-32183171 TGCCAGCTAAGAGTCCCTGCAGG + Exonic
1006840378 6:37024901-37024923 TGCCAGGCCACACTCTGTGCTGG + Intronic
1009701204 6:67183922-67183944 TGCCCAATAGAACTCTGTGCAGG - Intergenic
1010490230 6:76466997-76467019 TGCCAGCTAACAGTTTGTGGAGG - Intergenic
1012553498 6:100485766-100485788 TGCCATCCAAAAGACTGTGCAGG + Intergenic
1012668927 6:102015715-102015737 TGCCAGCCAAAGCACTTTGCAGG - Intronic
1012799082 6:103802482-103802504 TGAGATCTCAAACTCTGTGCTGG - Intergenic
1013383755 6:109603552-109603574 TGAGATCTGAAACTCTGTGCTGG + Intronic
1013387445 6:109645713-109645735 TCAGAGCTCAAACTCTGTGCTGG - Intronic
1014641549 6:123916670-123916692 TGGCATCTAAAAATCTGTGAAGG - Intronic
1015131621 6:129817779-129817801 TGCCAGGTAACACTCAGGGCTGG + Intergenic
1017918254 6:158849571-158849593 TGCCAGCTAAAAGCCTGAACAGG - Intergenic
1018622405 6:165743062-165743084 TGCCAGCTAAGACACAGGGCAGG - Intronic
1019076795 6:169394375-169394397 TGACAGCTAGAACTCTGTGAAGG + Intergenic
1024266975 7:47614270-47614292 TACCAGTTAAAATTCTGTCCTGG - Intergenic
1026446731 7:70491123-70491145 TGCCAGGTAAACATCTGAGCAGG - Intronic
1035875950 8:3189867-3189889 TGCCCGCCAGAACTCTGTGGTGG - Intronic
1035997117 8:4560557-4560579 TGTGAGCTAAAACACTGTGCTGG + Intronic
1036207738 8:6817639-6817661 TTCCAGCCAAAACTTGGTGCTGG + Intronic
1039194858 8:35019742-35019764 TGCCAGAGAAAACTGTGTGGGGG + Intergenic
1041405101 8:57490410-57490432 TGCCAGATAAAAGTCTCTGCTGG + Intergenic
1042581319 8:70282311-70282333 TGCCAACAAAAAGACTGTGCAGG + Intronic
1047978096 8:130151523-130151545 TGACAGCTAAAAATCTCAGCTGG + Intronic
1048377091 8:133832267-133832289 TTCTACCTAAAACTCTGAGCTGG - Intergenic
1048875884 8:138836974-138836996 TCCCAGCTGGAACTCTGTGTGGG - Intronic
1048876371 8:138839569-138839591 TCCCAGCTGGAACTCTGTGTGGG - Intronic
1050192112 9:3037482-3037504 TTTCAGCTCAAACTCTGTTCTGG - Intergenic
1051267067 9:15319285-15319307 TTCCAGATAAATCTCTCTGCTGG - Intergenic
1054456386 9:65433454-65433476 TGCCAGCTGCATCTCTGGGCAGG + Intergenic
1055053173 9:71999985-72000007 TCCGAGCTCAAACACTGTGCTGG + Intergenic
1056997101 9:91473195-91473217 TCAGAGCTCAAACTCTGTGCTGG + Intergenic
1057094961 9:92297756-92297778 TGTCAGCTAAAACTGTTTTCTGG + Exonic
1059212667 9:112528366-112528388 TGCCACCTACCACCCTGTGCAGG + Intronic
1059578750 9:115520762-115520784 TCCCAGCTGAAACTCTGGCCTGG + Intergenic
1060705512 9:125795197-125795219 TCCCAGGTAAAAACCTGTGCAGG + Intronic
1186591193 X:10931681-10931703 TTCCAGGTACAACTATGTGCTGG - Intergenic
1188464085 X:30458459-30458481 TGCCAGATAAACCTTTTTGCAGG - Intergenic
1188841875 X:35026502-35026524 AACCAGCTACAACACTGTGCTGG + Intergenic
1192395931 X:70780961-70780983 TCCGAGCTCAAACACTGTGCTGG - Intronic
1193188769 X:78545002-78545024 TGCCAGCAAAAACACTCTGGTGG + Intergenic
1194381661 X:93199653-93199675 TTCCAGCTAAAAGTCTGCGGGGG - Intergenic
1195544466 X:106099946-106099968 TGCCAGCCAAAACACTTTGTAGG + Intergenic
1196370531 X:114974434-114974456 TTCCAGCTAAAAGAGTGTGCAGG - Intergenic
1199710698 X:150467098-150467120 TGCCAGCTCAGACTCCCTGCAGG + Intronic
1199911799 X:152295186-152295208 TCCGAGCTCAAACACTGTGCTGG + Intronic
1200836513 Y:7737563-7737585 AGCCAGCTAAAGATCTGTGGGGG - Intergenic