ID: 1002721140

View in Genome Browser
Species Human (GRCh38)
Location 5:181261908-181261930
Sequence TCGGAACCCTGGCCCGACGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002721140_1002721147 9 Left 1002721140 5:181261908-181261930 CCTGCGTCGGGCCAGGGTTCCGA No data
Right 1002721147 5:181261940-181261962 CTGAGCTCTGTGAGCTCGGCCGG No data
1002721140_1002721154 26 Left 1002721140 5:181261908-181261930 CCTGCGTCGGGCCAGGGTTCCGA No data
Right 1002721154 5:181261957-181261979 GGCCGGGAGGGGGCTGGATTTGG No data
1002721140_1002721153 20 Left 1002721140 5:181261908-181261930 CCTGCGTCGGGCCAGGGTTCCGA No data
Right 1002721153 5:181261951-181261973 GAGCTCGGCCGGGAGGGGGCTGG No data
1002721140_1002721148 10 Left 1002721140 5:181261908-181261930 CCTGCGTCGGGCCAGGGTTCCGA No data
Right 1002721148 5:181261941-181261963 TGAGCTCTGTGAGCTCGGCCGGG No data
1002721140_1002721150 14 Left 1002721140 5:181261908-181261930 CCTGCGTCGGGCCAGGGTTCCGA No data
Right 1002721150 5:181261945-181261967 CTCTGTGAGCTCGGCCGGGAGGG No data
1002721140_1002721144 5 Left 1002721140 5:181261908-181261930 CCTGCGTCGGGCCAGGGTTCCGA No data
Right 1002721144 5:181261936-181261958 AGCCCTGAGCTCTGTGAGCTCGG No data
1002721140_1002721152 16 Left 1002721140 5:181261908-181261930 CCTGCGTCGGGCCAGGGTTCCGA No data
Right 1002721152 5:181261947-181261969 CTGTGAGCTCGGCCGGGAGGGGG No data
1002721140_1002721149 13 Left 1002721140 5:181261908-181261930 CCTGCGTCGGGCCAGGGTTCCGA No data
Right 1002721149 5:181261944-181261966 GCTCTGTGAGCTCGGCCGGGAGG No data
1002721140_1002721155 27 Left 1002721140 5:181261908-181261930 CCTGCGTCGGGCCAGGGTTCCGA No data
Right 1002721155 5:181261958-181261980 GCCGGGAGGGGGCTGGATTTGGG No data
1002721140_1002721151 15 Left 1002721140 5:181261908-181261930 CCTGCGTCGGGCCAGGGTTCCGA No data
Right 1002721151 5:181261946-181261968 TCTGTGAGCTCGGCCGGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002721140 Original CRISPR TCGGAACCCTGGCCCGACGC AGG (reversed) Intergenic