ID: 1002721296

View in Genome Browser
Species Human (GRCh38)
Location 5:181262621-181262643
Sequence CAGAGGATGGAGATGGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002721287_1002721296 0 Left 1002721287 5:181262598-181262620 CCTGGATTTGTAGTCCCAGAGAA No data
Right 1002721296 5:181262621-181262643 CAGAGGATGGAGATGGGGGCTGG No data
1002721286_1002721296 10 Left 1002721286 5:181262588-181262610 CCAGGTCAGGCCTGGATTTGTAG No data
Right 1002721296 5:181262621-181262643 CAGAGGATGGAGATGGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002721296 Original CRISPR CAGAGGATGGAGATGGGGGC TGG Intergenic
No off target data available for this crispr