ID: 1002724216

View in Genome Browser
Species Human (GRCh38)
Location 5:181283673-181283695
Sequence TGGGGTGGGTAAGAAGCTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002724200_1002724216 19 Left 1002724200 5:181283631-181283653 CCAGGAAGGGGGAGTAGGAGAGC No data
Right 1002724216 5:181283673-181283695 TGGGGTGGGTAAGAAGCTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002724216 Original CRISPR TGGGGTGGGTAAGAAGCTGC CGG Intergenic
No off target data available for this crispr